Bacteriological Media state-wide in Himachal Pradesh

Bacteriological Media Tenders in Himachal Pradesh

Explore state-wide bacteriological media procurement opportunities in Himachal Pradesh. Major buyers include Central University Of Himachal Pradesh and Dg Armed Forces Medical Service. Tender values range from ₹11.6 Lakh to ₹14.1 Lakh. EMD ranges from ₹Infinity Cr to ₹-InfinityK. Procurement sources: Gem (6). Track active bids, eligibility criteria, and deadlines for this state.

Live Opportunities

National Reach

0 tenders

Oxalic acid graterthan 99point5 percent CAS 6153-56-6,2 4 Dinitrophenol 99 percent CAS 51-28-5 3x10

Central University Of Himachal Pradesh

KANGRA, HIMACHAL PRADESHPosted 22 Mar

GEMGoods3 Documents

Potassium hydroxide 1000 g,4 percent Paraformaldehyde 500 ml,Phenol chloroform isoamyl alcohol 300

Central University Of Himachal Pradesh

KANGRA, HIMACHAL PRADESHPosted 26 Mar

GEMGoods3 Documents

Category: Potassium hydroxide 1000 g , 4 percent Paraformaldehyde 500 ml , Phenol chloroform isoamyl alcohol 300 ml , Sodium carbonate 500 g , Thiobarbituric acid 125 g , Sodium hydroxide 1000 g , Superoxide Dismutase antioxidant assay kit calorimetric 1 , Riboflavin 100 g , Trypan Blue zero point four percent Solution 50 ml , Guaiacol 250 g , Iron chloride FeCl3 100 g , Potassium Ferricyanide 100 g , Iodine 100 g , Dichloromethane 100 ml , Iron sulfate FeSO4 500 g , Sodium Hypochlorite NaOCl 500 ml , Perchloric Acid HClO4 500 ml , Zinc Chloride ZnCl2 500 g , Sodium Iodide NaI 500 g , Phosphate Buffer 500 ml , DNA Extraction Kit for Animal tissue 2 , PCR kit 2 , PBS Phosphate buffered saline 1000 ml , Sodium Chloride 1000 g , Bouins fixative 500 ml , Bradford reagent 1000 ml , ALT Activity kit Calorimetric 50 rxn , AST Activity kit Calorimetric 50 rxn , ALP Activity kit Calorimetric 50 rxn , Giemsa stain 50 ml , Ethanol 15 L , Nitroblue tetrazolium NBT 25 g , S Acetylthiocholine iodide 25 g , Potassium cyanide 500 g , Drabkins reagent 500 ml , Hayemis RBC diluting fluid 100 ml , Turks WBC diluting fluid 100 ml , Heparin anticoagulant 50 ml , Hydrogen peroxide 1500 ml , 1 Chloro2 4 Dinitrobenzene CDNB AR 100 g , Glutathione Reduced GSH 25 g , Two point five percent Glutaraldehyde 500 ml , Diethyl ether AR 1000 ml , Petroleum ether AR grade 2500 ml , Pyrogallol 100 g , Nitric acid 1000 ml , Perchloric acid 1000 ml , Glacial acetic acid 1500 ml , L tryptophan extrapure 100 mg , Barium chloride dehydrate 500 g , Gum acacia 500 g , Magnesium chloride hexahydrate 500 g , Potassium nitrate 500 g , Methyl cellosolve 1000 ml , Citric acid 500 g , Sodium citrate tribasic dehydrate extrapure 98 percent 500 g , Anthrone ACS 98 percent 25 g , N propanol 1000 ml , Ammonium metavanadate 100 g , Phenol crystalline extrapure AR 500 g , Boric acid 500 g , Papain 100 g , Ferric chloride hexahydrate A 100 g , Starch 1000 g , Donepezil hydrochloride 1 , Master mix PCR 100 rxn , DPPH 2 g , ATBS 5 g , CTAB 3 kit , Mcnkey broth 500 g , MHA muller hinton broth 500 g , Sterile disc 2 pack , Plate count agar 500 g , M17 agar 500 g , M17 broth 500 g , Ox bile Ox gall 500 g , MHA agar 500 g , MRS broth 1000 g , MRS agar 1000 g , Pepsin and cysteine 25 g each , X gal 5 bromo 4 chloro 3 indolyl beta D galactopyranoside 1 g , 10 micro leter IPTG iso propylthio beta D galactopyranoside 5 g , Columbia agar 500 g , DNA extraction kit for bacteria 1 pack , Molecular primer 27F 5AGAGTTTGATCCTGGCTCAG 3 and 1492R 5 TACGGTACCTTGTTACGACTT3 , Wurster reagent N N N N tetramethyl pphenylenediamine 10 g , Sucrose lactose maltose glucose fructose xylose sorbitol 500 g each , D Arabinose 100 g , D Reffinose 100 g , Gram staining kit 200 ml reagents , Trypsin 10 g , Nutrient Agar 500 g , Nutrient Broth 500 g

RPMI1640 Medium. HEPES Modifcation with L glutamine and 25mM HEPES without sodium bicarbonate powde

Central University Of Himachal Pradesh

KANGRA, HIMACHAL PRADESHPosted 9 Apr

GEMGoods3 Documents

Category: RPMI1640 Medium. HEPES Modifcation with L glutamine and 25mM HEPES without sodium bicarbonate powder suitable for cell culture , Fetal Bovine Serum non-USA origin sterile fltered suitable for cell culture , Ethanol absolute. for analysis EMPARTA ACS , Trypsin from porcine pancreas lyophilized powder BioReagent , Thiazolyl Blue Tetrazolium Bromide powder BioReagent suitable for cell culture suitable for insect cell culture , Trypan Blue solution , Corning syringe flters , LB Broth with agar , LB Broth Miller Highly- referenced nutrient-rich microbial growth powder medium suitable for regular E coli culture , Ethylene glycol analytical standard , Ethylenediaminetetraacetic acid ACS reagent , Zinc acetate , Polyvinylpyrrolidone mol wt number average molecular weight , Gadolinium III nitrate hexahydrate , Chromium III nitrate nonahydrate , Cadmium chloride , N N Dimethylformamide ACS reagent , I Sodium citrate anhydrous EMPROVE ESSENTIAL , Ascorbic acid , Hydrogen peroxide solution , Hydrazine hydrate solution , Tetra-n- butyl orthotitanate , Ferric nitrate nonahydrate , Magnesium nitrate hexahydrate , Samarium III nitrate hexahydrate , acetic acid , Poly vinyl alcohol pva , Samarium III oxide , Niobium V oxide , Molybdenum IV oxide , Samarium powder for synthesis , Cobalt II chloride anhydrous , Nickel II chloride , Lithium chloride , Hydrofluoric acid , Silver nitrate solution , Ammonium hydroxide solution , Silicon nanoparticles

Refine Your Search

Quick filters based on popular searches

Popular

Top States

Top Cities

Top Organizations

Sources

Click any filter to narrow down your results • Applied filters shown with opacity

Sodium Hypochlorite 5 percent,ELISA reader thermal paper for,Acetone Commercial,Alcohol Methyl,Bloo

Indian Army

SHIMLA, HIMACHAL PRADESHPosted 26 Jul

GEMGoods3 Documents

Category: Sodium Hypochlorite 5 percent , ELISA reader thermal paper for , Acetone Commercial , Alcohol Methyl , Blood Agar Base Infusion Agar , Chloroform AR Analytical grade , Cled Agar with Thymol Blue , Gram stain , Rapid test kit for Dengue NS1 Ag plus IgM plus IgG antibody combo card Kit of 10 test , RA Factor Test Kit 25 tests Latex agglutination method , Reagant strips for Urinanlysis. Multistix 10 G siemenes , HIV I and II Rapid test kit set of 50 , Pregnancy Test Strip mankind , kit for estimation of Lipase kit 1x24ml ERBA , Kits for estimation of Albumin ERBA , Kits for estimation of Cholesterol ERBA , Kits for estimation of Glucose ERBA , Kits for estimation of Protein ERBA , Kits for estimation of Urea ERBA , Kits for estimation of Uric Acid ERBA , Kits for estimation of Creatinine ERBA , Kits for estimation of SGOT AST ERBA , Kits for estimation of SGPT ALT ERBA , MacConkey Agar , Mueller Hinton Agar , Prothrombin time reagents to give control of 10-14 secs ERBA , PTTK Reagent ERBA , Strips Albumin and glucose bottle of 100 strips , Xylene Xylol Pure , Occult blood test kit Kit of 50 tests , Paracheck for PV or PF Kit of 50 , Kit for triglyceride estimation 100 ml ERBA , Kit for estimation of GGT Gamma Glutamyl Transaminase 12 x 5 ml ERBA , Kit for estimation of calcium 50 ml ERBA , Kit for estimation of Amylase 12 x 5 ml ERBA , Kit for estimation of LDH 12 x 5 ml ERBA , Rapid card screening for HBV set of 50 test , Rapid card screening for HCV , C reactive Protein kit for 50 tests ERBA , PT Reagent kit of 25 tests , Blood Culture Bottle Adult , Blood Culture Bottle Paediatric , Calcium kit 2 X 50 ml ERBA , Cell Cleaner 50ml Sysmex , CK -MB kit Erba 5 X6.5 ml , Cleaning Solution For Electrolyte Analyser , Cytochrome Stain Modified Leishman Bott Of 500 Ml , Distilled Water , ESR Tube Disposal pkt of 100 tube , H360 Cell Clean Bott Of 50 Ml ERBA , H360 Diluent Pack Of 20 Ltr ERBA , H360 Lyase Bott Of 500 Ml Erba , Haematoxilin Himedia Ready to use , Internal Filling Solution For Electrolyte Analyser , LDH KIT ERBA , Mac Conkey Broth Double Strength With Neutral Red , Micro Protein Kit ERBA , Petridish , Sterile urine container , Stomatolyser 500ml Sysmex , Syphilies Test Kit 50 Test , Sysmex Hematology Qc and Calibration , Typhi Dot IgG and IgM Kit of 50 Test , Vitamin B12 Elisa Kits Set Of 96 , Widal Kit ERBA , Printer Roll Sysmax 300 p , ANA test kit , weil flex test kit , Solution pack NA K CL Pack of 800 ml , Cleaning solution Easylite medica , ERBA H3 Con tri level 3x3 ml , Ink Refill for HP deskjet inj advantage 4178 printer for ultrasound machine samsung HS70A , COLOUR PRINTING PACK UPC-21L WITH 200 SHEETS OF A6 SIZE PRINT MEDIA AND 4 COLOUR INK RIBBONS - TO BE USED WITH PRINTER UP-D25MD , Disposable Needle 26 G , Cotton tipped buds Packet of 100 , Bandage contact lens , DISPOSABLE CRESCENT BLADE 50 DEGREE ANGLED , Lens cleaner spray , Dark Goggles with side cover for post operative catarat cases , Precision surgical skin marker sterile , Encore Sterile powder free latex free gloves 6.5 , Encore Sterile powder free latex free gloves 7.5 , Punctal Plug , Sponge Spears Pkt of 5 , Disposable Cannula 27G for Intraocular , MVR BLADE 20G , ECG Roll 210 mmx 20 mm

Petri plates,Conical glass flasks,Conical glass flasks,Laboratory tray,Instrument tray,Glass beaker

Indian Council Of Forestry Research And Education (icfre)

SHIMLA, HIMACHAL PRADESHPosted 19 Aug

GEMGoods4 Documents

Category: Petri plates , Conical glass flasks , Laboratory tray , Instrument tray , Glass beakers , Gloves , Blotting sheets , Surgical blades , Aluminum foil , Type 1 creped toilet paper , Glass test tubes , Test tube stand three tier , Potato Dextrose Agar , Ethanol , Copper sulphate , Copper acetate , Labolene Teepol , Sabouraud Dextrose Agar , n-Hexane , Agar Powder Bacteriological , Sodium hydroxide pellets , Potassium hydroxide pellets , Poly ethylene glycol , Chloromphenicol , Silica gel , Bovine serum albumin , Talc , Buffer capsule , Microcrystalline cellulose , Flower Pots Tray , Flower Pots Round , Watering can for gardening

Dg Armed Forces Medical Service Widal Test Kit and Reagents Tender Kangra Himachal Pradesh 2025

Dg Armed Forces Medical Service

KANGRA, HIMACHAL PRADESHPosted 15 Dec

GEMGoods3 Documents

Category: Widal Test Kit , CRP Quantative 1 20 test , HbA1c Tulip Turbodyne 1x , DspaceDimer 1x20 Test T , EspaceCheck Quality , RA Factor Qualitative , PC Lyte Electrolyte Reagent , Sterile Urine Container , Kit for Estimation of Ckspa , Dengue J Mitra NS1Ag and I , Prothrombine Time Reagent , Cell Pack XPspace100 , Stromatolyser XPspace100 , Readymade Leishman St , Muller Hinton Agar MHA , Slide Microscopic Thickne , Micro Cover Glasses 22x50 , VDRL Rapid Test Kit pack of , Wire Loop for Culture , Strips Albumin and Glucose , Swab Stick , PTTK Test Kit with Cacl2 , Cell Clean Sysmax , Multi Stick 10SG pkt of 100 Urosticks Siemens , Blood Sedimentation Rate P , Elisa Reader Thermal Paper , Pci Lyte Print Paper Roll , Pci Lyte Pump Tube , Pci Lyte Deproteinizer , Pci Lyte Cleaning Sol , Pci Lyte Activating Sol Electrolyte Analyser , Gram Stain Kit , ZN Stain Kit , CRP Qualitative , Serum Anti A1 , Anti D IgG and IgM , Serum Anti H 1x5 ml , Serum Anti Human Globulin , Bovine Serum Albumi , Anti D IgG Bott of 10 ml , Anti D IgM Bott of 10 ml , Formaldehide 40percent , Abs Alcohol Dehydrate , Acetone Commersial , Parafin Wax , Acid Sulfuric Commersial , Rapid PAP Stain , Xylene , Readymade Hemotoxyline Stain , Blood Agar Base , Cled Agar with Indic , Sugar Set Readymade for , Sabouraud Dextrose Agar , KOH 40percent , KOH 20percent , Settle Plate , Rodac Plate , LPCB , Gentamycin 10 mcg ABST , Netilmicin 30 mcg ABS , Levofloxacin 5 mcg ABS , Ciprofloxacin 5 mcg A , Trimethoprim 1 25slas , Naldixic Acid 30 mcg ABST , PipracilinslashTazobact , Cefotaxime 30 mcg ABST , Meropenem 10 mcg AB , Norfolaxacin 10 mcg ABST , Clindamycin 2 mcg ABST , Amikacin 30 mcg ABST , Vancomycin 30 mcg ABS , Linezolid 30 mcg ABST Di , Ofloxacin 5 mcg ABST Disc , Imipenem 10 mcg ABST Di , Tobramycin 10 mcg ABST , Ampicillin 10 mcg A , Nitrofurantoin 300 , Ceftazidime 30 mcg ABST , Amoxyclav 30 mcg A , Ceftriaxone 30 mcg , Cefixime 5 mcg ABST Disc , CefoperazoneslashSulbact , Amoxycillin 30 mcg ABST , CSF Microprotein Detection , CSF Globulin Detection Kit , Feather Microtome Blade