TenderDekho Logo
Boron state-wide in Himachal Pradesh

Boron Tenders in Himachal Pradesh

Explore state-wide boron procurement opportunities in Himachal Pradesh. Track active bids, eligibility criteria, and deadlines for this state.

Location
Authority
0

Petroleum ether 4L,Boric Acid 1000 g,Sodium Chloride 1000 g,Perchloric acid 70 percent 500 ml,Nitri

Central University Of Himachal Pradesh

KANGRA, HIMACHAL PRADESHPosted 29 Jan
GEMGoods3 Documents
Category: Petroleum ether 4L , Boric Acid 1000 g , Sodium Chloride 1000 g , Perchloric acid 70 percent 500 ml , Nitric acid 500 ml , n hexane 1500 ml , HCl 37 percent 1500 ml , Methanol 7000 ml , Potassium hydroxide pellets 200 g , Sodium sulphate anhydrous 1L , Ethanol Absolute 99 point 9 percent 40 L , Phosphate buffer saline 1000 ml , Standard Vitamins A or Retinyl palmitate 200 mg , Trichloroacetic acid 500 mg , Absolute alcohol 1000 ml , 2 2 dipyridyl 200 g , Ferric chloride or F2eCl36H20 200 g , Sodium bicarbonate 500 g , Oxalic acid 4 percent 500 ml , Xylene 1 L , 2 6 Dichlorophenol indophenol 500 g , Sulphuric acid 2 L , Thiourea 100 g , Bromine water 500 ml , Vitamin C or Ascorbic acid standard 10 g , Vitamin D standard D2 Ergocalciferol 5 g , Vitamin D standard D3 Cholecaliferol 10 g , 2 propanol 200 ml , Potassium ferricyanide 250 g , Standard thiamine Hydrochloride 200 g , Isobutyl alcohol 300 ml , Riboflavin standard 100 g , P2O5 50 g , Sodium hydrosulphite 50 g , Papain 200 g , Sodium acetate buffer 7 500 ml , Standard tryptophan 200 g , Chloroform 2500 ml , High capacity cDNA reverse transcription kit Cdna kit 50 reactions , DPX 500 ml , TRIS 500 g , Urea 500 g , Red Congo agar 500 g , Tryptic soy agar 500 g , MRS agar 500 g , Nutrient agar 500 g , Casein hydrolysis agar 500 g , Christensens urea agar 500 g , Starch hydrolysis agar 500 g , Tryptophan peptone broth 500 g , MRS broth 500 g , Phenol red carbohydrate broth 500 g , Nutrient broth 500 g , Motility test medium 500 g , Nitrite and nitrate reduction media 500 g each , Tryptic soy broth 500 g , Pepsin, tryptophan and cysteine 50 g each , Kovacs oxidase reagent 20 ml , Kovacs indole reagent 100 ml , Hydrogen peroxide 30 percent 500 ml , Phenol red powder 25 g , Potassium hydroxide 500 g , Rnase 20 ml , Proteinase k 20 ml , Amoxiclav 1 vial of 100 discs , Amoxycillin 1 vial of 100 discs , Streptomycin 1 vial of 100 discs , Erythromycin 1 vial of 100 discs , Vancomycin 1 vial of 100 discs , Tetracycline 1 vial of 100 discs , Chloramphenicol 1 vial of 100 discs , Clindamycin 1 vial of 100 discs , Oxacillin 1 vial of 100 discs , Cephalothin 1 vial of 100 discs , Penicillin G 1 vial of 100 discs , Beef extract powder 500 g , Molecular primer Forward primer GM3 5AGAGTTTGATCMTGGC 3 and Reverse Primer GM4 5TACCTTGTTACGACTT3
Deadline
24 Feb 2025
View Details

FCP reagent,Gallic acid,DPPH,Ethanol,Cur Std,Cur-PCL,Acetone,LiCl,LiNO3,SBR binder,1-10 Phen C12H8N

Central University Of Himachal Pradesh

KANGRA, HIMACHAL PRADESHPosted 18 Feb
GEMGoods3 Documents
Category: FCP reagent , Gallic acid , DPPH , Ethanol , Cur Std , Cur- PCL , Acetone , LiCl , LiNO3 , SBR binder , 1-10 Phen C12H8N2 , Iron trichloride FeCl3 , CoCl2 , Thorin indicator , Lithium hydroxide LiOH.H2O , Potassium periodate KIO4 , Polyvinylidene fluoride binder PVDF , Lithium nitride Li3N , Graphite , Manganese chloride MnCl2 , Nickle chloride NiCl2 , Cobalt nitrate CoNO32 , Manganese nitrate MnN2O6 , Nickle nitrate Ni,NO32 , Methyl acetate , Methyl carbonate , Di-methyl carbonate , Potassium ferricyanide , Neutral red , Disodium anthraquinone-2.6-disulfonate , Platinum oxide , Vitamin K1 Ready Made Solution , TBATFB NBu4BF4 , Sulfuric Acid , NaOH , Boric Acid , Copper or Selenium Catalyst , Methyl red indicator , HCLO4 , NH4 6M07024.4H20 , TARTARIC ACID , Na2SO3 , C8H10K2O15Sb2 , ASCORBIC ACID , H2O2 , N, C, K, NH4 M , F-, Cl-, NO3-, PO4-, SO4-, Br- , Filter paper220nmdi25mm , Syringes 10 ml , Al Heavy duty foil , L.-cysteine , Elec PolKit pk 4 , Arsenic oxide , Chromium chloride , Potassium dichromate , Graphene oxide , Carbon nanotube , Nano diamonds , Carbon nanofibers , C3H5BrClN3 , Glycerol , Ethylene glycol , Diethylene glycol , Triethylene glycol , Ethylene diamine , bi no3 3 5h2o , Na2S-H2O , Citric acid , 5-furouracil , Para-aminophenol , Flutamide , Urea , Thioacetamide , Tetracycline , Metronidazole , Thiophene , Pyrrole , 2 6 ndca
Deadline
11 Mar 2025
View Details

Potassium hydroxide 1000 g,4 percent Paraformaldehyde 500 ml,Phenol chloroform isoamyl alcohol 300

Central University Of Himachal Pradesh

KANGRA, HIMACHAL PRADESHPosted 26 Mar
GEMGoods3 Documents
Category: Potassium hydroxide 1000 g , 4 percent Paraformaldehyde 500 ml , Phenol chloroform isoamyl alcohol 300 ml , Sodium carbonate 500 g , Thiobarbituric acid 125 g , Sodium hydroxide 1000 g , Superoxide Dismutase antioxidant assay kit calorimetric 1 , Riboflavin 100 g , Trypan Blue zero point four percent Solution 50 ml , Guaiacol 250 g , Iron chloride FeCl3 100 g , Potassium Ferricyanide 100 g , Iodine 100 g , Dichloromethane 100 ml , Iron sulfate FeSO4 500 g , Sodium Hypochlorite NaOCl 500 ml , Perchloric Acid HClO4 500 ml , Zinc Chloride ZnCl2 500 g , Sodium Iodide NaI 500 g , Phosphate Buffer 500 ml , DNA Extraction Kit for Animal tissue 2 , PCR kit 2 , PBS Phosphate buffered saline 1000 ml , Sodium Chloride 1000 g , Bouins fixative 500 ml , Bradford reagent 1000 ml , ALT Activity kit Calorimetric 50 rxn , AST Activity kit Calorimetric 50 rxn , ALP Activity kit Calorimetric 50 rxn , Giemsa stain 50 ml , Ethanol 15 L , Nitroblue tetrazolium NBT 25 g , S Acetylthiocholine iodide 25 g , Potassium cyanide 500 g , Drabkins reagent 500 ml , Hayemis RBC diluting fluid 100 ml , Turks WBC diluting fluid 100 ml , Heparin anticoagulant 50 ml , Hydrogen peroxide 1500 ml , 1 Chloro2 4 Dinitrobenzene CDNB AR 100 g , Glutathione Reduced GSH 25 g , Two point five percent Glutaraldehyde 500 ml , Diethyl ether AR 1000 ml , Petroleum ether AR grade 2500 ml , Pyrogallol 100 g , Nitric acid 1000 ml , Perchloric acid 1000 ml , Glacial acetic acid 1500 ml , L tryptophan extrapure 100 mg , Barium chloride dehydrate 500 g , Gum acacia 500 g , Magnesium chloride hexahydrate 500 g , Potassium nitrate 500 g , Methyl cellosolve 1000 ml , Citric acid 500 g , Sodium citrate tribasic dehydrate extrapure 98 percent 500 g , Anthrone ACS 98 percent 25 g , N propanol 1000 ml , Ammonium metavanadate 100 g , Phenol crystalline extrapure AR 500 g , Boric acid 500 g , Papain 100 g , Ferric chloride hexahydrate A 100 g , Starch 1000 g , Donepezil hydrochloride 1 , Master mix PCR 100 rxn , DPPH 2 g , ATBS 5 g , CTAB 3 kit , Mcnkey broth 500 g , MHA muller hinton broth 500 g , Sterile disc 2 pack , Plate count agar 500 g , M17 agar 500 g , M17 broth 500 g , Ox bile Ox gall 500 g , MHA agar 500 g , MRS broth 1000 g , MRS agar 1000 g , Pepsin and cysteine 25 g each , X gal 5 bromo 4 chloro 3 indolyl beta D galactopyranoside 1 g , 10 micro leter IPTG iso propylthio beta D galactopyranoside 5 g , Columbia agar 500 g , DNA extraction kit for bacteria 1 pack , Molecular primer 27F 5AGAGTTTGATCCTGGCTCAG 3 and 1492R 5 TACGGTACCTTGTTACGACTT3 , Wurster reagent N N N N tetramethyl pphenylenediamine 10 g , Sucrose lactose maltose glucose fructose xylose sorbitol 500 g each , D Arabinose 100 g , D Reffinose 100 g , Gram staining kit 200 ml reagents , Trypsin 10 g , Nutrient Agar 500 g , Nutrient Broth 500 g
Deadline
16 Apr 2025
View Details

one three Dinitrobenzene,2 2 azino bis 3 Ethylbenzothiazoline 6 sulphonic acid ABTS,2 Propanol,3 5

Central University Of Himachal Pradesh

KANGRA, HIMACHAL PRADESHPosted 19 Nov
₹5.0 L
GEMGoods3 Documents
Category: one three Dinitrobenzene , 2 2 azino bis 3 Ethylbenzothiazoline 6 sulphonic acid ABTS , 2 Propanol , 3 5 Dimethoxy 4 hydroxyacetophenone Acetosyringone , Acetone , Acetic Acid Glacial , Acetonitrile , Acrylamide , Activated Charcoal powder , Aluminium potassium sulphate dodecahydrate Potash Alum , Ammonia Solution Ammonium Hydroxide , Ammonium chloride , Ancymidol , Andrographolide , Bismuth III subnitrate , Bromine Water , Bromocresol Green , Bromocresol purple , Carboxymethyl cellulose sodium salt , Chitin , Chitosan , Chloroform , Citric Acid monohydrate , Curzerenone , Dextrose D plus Glucose anhydrous , Diethylene glycol , DMSO , DPPH 2 2 Diphenyl 1 picrylhydrazyl , Dragendorff s Reagent , Ethanol , Ethyl Acetate , Ethylene Glycol , Ferrous chloride tetra hydrate , Formaldehyde , Glycerol , Hydrochloric Acid , Hydrogen Peroxide , Hyperoside , Jasmonic Acid , lactic acid , L Ascorbic acid , Litmus solution blue , Litmus solution Red , Luria Bertani Agar Miller Miller Luria Bertani Agar , Luria Bertani Broth Miller Miller Luria Bertani Broth , Mercuric Chloride , Methanol , Methyl orange , Methyl red , Millons Reagent , Molisch Reagent , Mueller Hinton Agar , Mueller Hinton Broth , Murashige and Skoog media wCaCl2 and vitamins and sucrose wo agar , Murashige and Skoog Medium w CaCl2 and Vitamins wo Sucrose and Agar , Murashige and Skoog Microelements solution 100X , Murashige and Skoog Vitamins 1000x , Murashige and SkoogMacroelements Solution 10X , n butanol , Neoandrographolide , n Hexane , Ninhydrin , Nitric Acid , n propanol , Paclobutrazol , Perchloric Acid , Petroleum Ether , Phenol Crystal , Phenolphthalein , Potassium dichromate , Potassium Iodide , Potassium permanganate , Quercetin , Rottlerin , Silica Gel G for TLC , Silver Nitrate , Sodium bicarbonate , Sodium bisulphite , Sodium Carbonate anhydrous , Sodium chloride , Sodium Hydroxide , Sodium lactate , sodium nitroprusside solution , Sucrose , Sulphuric Acid , Tartaric acid , Toluene , Tween 80 , Universal Indicator solution , Wagner reagent , Xylene , Agarose , Ammonium Acetate , Ammonium persulphate , Isoamyl Alcohol , Boric Acid , Bromophenol Blue , Coomassie Briliant Blue , CTAB N Cetyl N N N trimethylammonium bromide buffer , DNA Polymerase with standard Taq Buffer with MG2 plus , dNTPs , Ethidium Bromide , Polyvinylpyrrolidone , TEMED , Tris HCl , Xylene cyanol , Urea , Acryl 29 ratio 1 3dot 3 cross linker , 10X TBE solution , Phenol , MgCl2 , DNA Ladder , Protein markers , Primers forward n reverse , Plant Genomic DNA isolation Teaching Kits , RNA extraction Teaching Kits , PCR Teaching Kits , Diphenyl amine reagent , Saline citrate buffer pH 7 , DEPEC water , RNA Ladder , DNA Amplification Universal Primers , Diluent for DNA Extraction
Deadline
10 Dec 2025
View Details

Boron trifluoride diethyl etherate Synthesis Grade 4 bottle each 25 mL,Gamma-Aminobutyric acid Synt

Central University Of Himachal Pradesh

KANGRA, HIMACHAL PRADESHPosted 26 Feb
GEMGoods3 Documents
Category: Boron trifluoride diethyl etherate Synthesis Grade 4 bottle each 25 mL , Gamma-Aminobutyric acid Synthesis Grade 25 g , Azobisisobutyronitrile Synthesis Grade 100 mL , MWCNT -COOH acid functionalized G.T. 90 Percentage carbon basis 9.5 nm by 1.5 um 1 g , Diamond, nanopowder L.T. 10 nm TEM G.T. equal to 95percent trace metals basis 5 g , TLC aluminum sheets Silica gel 60 F254 25 sheets 20 cm by 20 cm , Polyethylene, Ultra-high mol. Wt. surface-modified powder 34-50 mm 100 g , Funnel, Buncher, Thin Stem, made of porcelain, diameter 20 mm. , Funnel, Buncher, Thin Stem, made of porcelain, diameter 50 mm. , Funnel, Buncher, Thin Stem, made of porcelain, diameter 86 mm. , Evaporation flask for Rota eveporator NS 29 or 32 100 mL , Evaporation flask for Rota eveporator NS 29 or 32 250 mL , Chromatography columns, length 300 mm, diameter 15 mm with PTFE Key , Chromatography columns, length 500 mm, diameter 30 mm with PTFE Key , Flasks Buncher Filtering Heavy wall Tubulation, Socket and silicon cork 100 mL , Flasks Buncher Filtering Heavy wall Tubulation, Socket and silicon cork 250 mL , Filter paper, No.1 diameter 110 mm, pack of 100
Deadline
19 Mar 2026
View Details
Chat with us