TenderDekho Logo
Deoxyribonucleic Acid Analysis Kits state-wide in Himachal Pradesh

Deoxyribonucleic Acid Analysis Kits Tenders in Himachal Pradesh

Access live Deoxyribonucleic Acid Analysis Kits procurement tenders in Himachal Pradesh state

Location
Authority
0

Potassium hydroxide 1000 g,4 percent Paraformaldehyde 500 ml,Phenol chloroform isoamyl alcohol 300

Central University Of Himachal Pradesh

KANGRA, HIMACHAL PRADESHPosted 26 Mar
GEMGoods3 Documents
Category: Potassium hydroxide 1000 g , 4 percent Paraformaldehyde 500 ml , Phenol chloroform isoamyl alcohol 300 ml , Sodium carbonate 500 g , Thiobarbituric acid 125 g , Sodium hydroxide 1000 g , Superoxide Dismutase antioxidant assay kit calorimetric 1 , Riboflavin 100 g , Trypan Blue zero point four percent Solution 50 ml , Guaiacol 250 g , Iron chloride FeCl3 100 g , Potassium Ferricyanide 100 g , Iodine 100 g , Dichloromethane 100 ml , Iron sulfate FeSO4 500 g , Sodium Hypochlorite NaOCl 500 ml , Perchloric Acid HClO4 500 ml , Zinc Chloride ZnCl2 500 g , Sodium Iodide NaI 500 g , Phosphate Buffer 500 ml , DNA Extraction Kit for Animal tissue 2 , PCR kit 2 , PBS Phosphate buffered saline 1000 ml , Sodium Chloride 1000 g , Bouins fixative 500 ml , Bradford reagent 1000 ml , ALT Activity kit Calorimetric 50 rxn , AST Activity kit Calorimetric 50 rxn , ALP Activity kit Calorimetric 50 rxn , Giemsa stain 50 ml , Ethanol 15 L , Nitroblue tetrazolium NBT 25 g , S Acetylthiocholine iodide 25 g , Potassium cyanide 500 g , Drabkins reagent 500 ml , Hayemis RBC diluting fluid 100 ml , Turks WBC diluting fluid 100 ml , Heparin anticoagulant 50 ml , Hydrogen peroxide 1500 ml , 1 Chloro2 4 Dinitrobenzene CDNB AR 100 g , Glutathione Reduced GSH 25 g , Two point five percent Glutaraldehyde 500 ml , Diethyl ether AR 1000 ml , Petroleum ether AR grade 2500 ml , Pyrogallol 100 g , Nitric acid 1000 ml , Perchloric acid 1000 ml , Glacial acetic acid 1500 ml , L tryptophan extrapure 100 mg , Barium chloride dehydrate 500 g , Gum acacia 500 g , Magnesium chloride hexahydrate 500 g , Potassium nitrate 500 g , Methyl cellosolve 1000 ml , Citric acid 500 g , Sodium citrate tribasic dehydrate extrapure 98 percent 500 g , Anthrone ACS 98 percent 25 g , N propanol 1000 ml , Ammonium metavanadate 100 g , Phenol crystalline extrapure AR 500 g , Boric acid 500 g , Papain 100 g , Ferric chloride hexahydrate A 100 g , Starch 1000 g , Donepezil hydrochloride 1 , Master mix PCR 100 rxn , DPPH 2 g , ATBS 5 g , CTAB 3 kit , Mcnkey broth 500 g , MHA muller hinton broth 500 g , Sterile disc 2 pack , Plate count agar 500 g , M17 agar 500 g , M17 broth 500 g , Ox bile Ox gall 500 g , MHA agar 500 g , MRS broth 1000 g , MRS agar 1000 g , Pepsin and cysteine 25 g each , X gal 5 bromo 4 chloro 3 indolyl beta D galactopyranoside 1 g , 10 micro leter IPTG iso propylthio beta D galactopyranoside 5 g , Columbia agar 500 g , DNA extraction kit for bacteria 1 pack , Molecular primer 27F 5AGAGTTTGATCCTGGCTCAG 3 and 1492R 5 TACGGTACCTTGTTACGACTT3 , Wurster reagent N N N N tetramethyl pphenylenediamine 10 g , Sucrose lactose maltose glucose fructose xylose sorbitol 500 g each , D Arabinose 100 g , D Reffinose 100 g , Gram staining kit 200 ml reagents , Trypsin 10 g , Nutrient Agar 500 g , Nutrient Broth 500 g
Deadline
16 Apr 2025
View Details

MRS agar,MRS broth,Proteinase K,Rnase,Isopropanol,Amoxycillin,Chloramphenicol,Tetracycline,Erythrom

Central University Of Himachal Pradesh

KANGRA, HIMACHAL PRADESHPosted 13 Jan
₹4.8 L
GEMGoods4 Documents
Category: MRS agar , MRS broth , Proteinase K , Rnase , Isopropanol , Amoxycillin , Chloramphenicol , Tetracycline , Erythromycin , Master mix , Phenol chloroform isoamyl alcohol , n- Hexadecane , Resazurin dye , Sucrose and Lactose , Molecular primer , Skimmed milk agar , Litmus Skim milk broth , 2 2 azino bis 3 ethylbenzothiazoline 6 sulfonic acid ABTS , Spirit , Ethanol , Tetrahydrofuran , Mineral Salt agar , Minimal Broth w o Dextrose , Oxidase discs , Urease discs , Nitrate reagent Discs Twin pack , HiIMViC Biochemical test kit , Alamar Blue Reagent , Solasodine, C27H43NO2 95percent Purity HPLC grade , solanine C45H73NO15 95percent Purity HPLC grade , Vitexin C21H20O10 95percent Purity HPLC grade , Luteolin C15H10O6 95percent Purity HPLC grade , Benzaldehyde , N amyl acetate , 2 7 dichlorofluoroescein , Glycerol , Polyvinyl chloride , 2 3 5 triphenyltetrazolium chloride , Acetic acid , Antimony trichloride , Ethyl acetate , Sodium iodide , Sodium hydroxide , Potassium hydroxide , Ferric alpha alpha dipyridyl reagent , HPLC grade Ethanol 100 percent , Dulbeccos Modified Eagle Medium DMEM High Glucose , Dulbeccos Modified Eagle Medium DMEM Low Glucose , RPMI , DMSO Dimethyl Sulfoxide , Fetal Bovine Serum FBS , Trypsin , DCFH DA 2 7 Dichlorofluorescein diacetate , Methanol , Phosphate Buffered Saline PBS , Penicillin Powdered form , Streptomycin Powdered form , Vancomycin Powdered form , Tetracycline Powdered form , Azithromycin Powdered form , Clindamycin Powdered form , High capacity cDNA reverse transcriptase kit 50 reaction , RNA Isolation Kit 50 rxn , MTT powder , MH agar , MH broth , Nutrient broth , Nutrient agar media , TRIzol , Myrcene , Putrescine , Trimethylamine , Ethyl Butyrate , Limonene , CMC Agar Salt , Bacteria g DNA Isolation Kit Purification Genomic , Xylan , Lignin
Deadline
3 Feb 2026
View Details
Chat with us