Glacial Acetic Acid state-wide in Himachal Pradesh

Glacial Acetic Acid Tenders in Himachal Pradesh

Explore state-wide glacial acetic acid procurement opportunities in Himachal Pradesh. Track active bids, eligibility criteria, and deadlines for this state.

Location

Authority

0 tenders

Potassium hydroxide 1000 g,4 percent Paraformaldehyde 500 ml,Phenol chloroform isoamyl alcohol 300

Central University Of Himachal Pradesh

KANGRA, HIMACHAL PRADESHPosted 26 Mar

GEMGoods3 Documents

Category: Potassium hydroxide 1000 g , 4 percent Paraformaldehyde 500 ml , Phenol chloroform isoamyl alcohol 300 ml , Sodium carbonate 500 g , Thiobarbituric acid 125 g , Sodium hydroxide 1000 g , Superoxide Dismutase antioxidant assay kit calorimetric 1 , Riboflavin 100 g , Trypan Blue zero point four percent Solution 50 ml , Guaiacol 250 g , Iron chloride FeCl3 100 g , Potassium Ferricyanide 100 g , Iodine 100 g , Dichloromethane 100 ml , Iron sulfate FeSO4 500 g , Sodium Hypochlorite NaOCl 500 ml , Perchloric Acid HClO4 500 ml , Zinc Chloride ZnCl2 500 g , Sodium Iodide NaI 500 g , Phosphate Buffer 500 ml , DNA Extraction Kit for Animal tissue 2 , PCR kit 2 , PBS Phosphate buffered saline 1000 ml , Sodium Chloride 1000 g , Bouins fixative 500 ml , Bradford reagent 1000 ml , ALT Activity kit Calorimetric 50 rxn , AST Activity kit Calorimetric 50 rxn , ALP Activity kit Calorimetric 50 rxn , Giemsa stain 50 ml , Ethanol 15 L , Nitroblue tetrazolium NBT 25 g , S Acetylthiocholine iodide 25 g , Potassium cyanide 500 g , Drabkins reagent 500 ml , Hayemis RBC diluting fluid 100 ml , Turks WBC diluting fluid 100 ml , Heparin anticoagulant 50 ml , Hydrogen peroxide 1500 ml , 1 Chloro2 4 Dinitrobenzene CDNB AR 100 g , Glutathione Reduced GSH 25 g , Two point five percent Glutaraldehyde 500 ml , Diethyl ether AR 1000 ml , Petroleum ether AR grade 2500 ml , Pyrogallol 100 g , Nitric acid 1000 ml , Perchloric acid 1000 ml , Glacial acetic acid 1500 ml , L tryptophan extrapure 100 mg , Barium chloride dehydrate 500 g , Gum acacia 500 g , Magnesium chloride hexahydrate 500 g , Potassium nitrate 500 g , Methyl cellosolve 1000 ml , Citric acid 500 g , Sodium citrate tribasic dehydrate extrapure 98 percent 500 g , Anthrone ACS 98 percent 25 g , N propanol 1000 ml , Ammonium metavanadate 100 g , Phenol crystalline extrapure AR 500 g , Boric acid 500 g , Papain 100 g , Ferric chloride hexahydrate A 100 g , Starch 1000 g , Donepezil hydrochloride 1 , Master mix PCR 100 rxn , DPPH 2 g , ATBS 5 g , CTAB 3 kit , Mcnkey broth 500 g , MHA muller hinton broth 500 g , Sterile disc 2 pack , Plate count agar 500 g , M17 agar 500 g , M17 broth 500 g , Ox bile Ox gall 500 g , MHA agar 500 g , MRS broth 1000 g , MRS agar 1000 g , Pepsin and cysteine 25 g each , X gal 5 bromo 4 chloro 3 indolyl beta D galactopyranoside 1 g , 10 micro leter IPTG iso propylthio beta D galactopyranoside 5 g , Columbia agar 500 g , DNA extraction kit for bacteria 1 pack , Molecular primer 27F 5AGAGTTTGATCCTGGCTCAG 3 and 1492R 5 TACGGTACCTTGTTACGACTT3 , Wurster reagent N N N N tetramethyl pphenylenediamine 10 g , Sucrose lactose maltose glucose fructose xylose sorbitol 500 g each , D Arabinose 100 g , D Reffinose 100 g , Gram staining kit 200 ml reagents , Trypsin 10 g , Nutrient Agar 500 g , Nutrient Broth 500 g

Sodium Hydroxide,Benzoic Acid,Aniline 500 ml,Picric Acid 500 gm,Salicyclic acid 500 gm,Para nitro a

National Institute Of Technology (nit)

HAMIRPUR, HIMACHAL PRADESHPosted 4 Jun

GEMGoods3 Documents

Vanadium oxy trichloride 50 gm,Vacuum desiccator 250 mm,Draining tray 400mm by 300mm by 100mm,Aceto

National Institute Of Technology (nit)

HAMIRPUR, HIMACHAL PRADESHPosted 17 Jul

GEMGoods3 Documents

Acetic Acid,Acetone,Acetonitrile,Activated Carbon powder,Ammonium Chloride,Ammonium Hydroxide,Ammon

Himachal Pradesh State Civil Supplies Corporation Limited (hpscsc)

SHIMLA, HIMACHAL PRADESHPosted 4 Aug

GEMGoods4 Documents

Category: Acetic Acid , Acetone , Acetonitrile , Activated Carbon powder , Ammonium Chloride , Ammonium Hydroxide , Ammonium molybedate , Anhudrous monobasic Sodium phosphate , Anhydrous calcium chloride , Anhydrous Sodium Sulphate , Antimony trichloride , Barium Chloride , Barium hydroxide , Benzoic acid , Bromophenol blue indicator , Butanol , Butylated Hydroxytolune , Calcium carbonate , Calcium Chloride , Carbon tetrachloride , Chloroacetic acid , Chloroform , Chromic acid , Copper sulphate pentahydrate , Diethyl ether , Dimethly glyoxime solution , Disidium Hydrogen phosphate , Disodium ethylene diamine tetra acetate dihydrate , Distilled Water , Eriochrome Black T Indicator , Ethanol Pure , Ferric chloride , Ferrous sulphate , Ferrrous ammonium sulphate , Filter paper , Formic acid , Furfural solution , Glacial acetic acid , HPLC Grade water , Hydrochloric acid , Mask , Methanol , Methylene blue Indicator , Murexide , Nitric acid , Orthophosphoric Acid , p-dimethyl amino benzaldehyde , Petroleum ether , Phenolphathelein , Phloroglusinol , Phosphorus pentoxide , Picric acid , Poatassium Iiodate , Potassium aluminium sulphate , Potassium chromate , Potassium Dichromate , Potassium hydroxide , Potassium iodide , Potassium permagnate , Potassium persulphate , Potassium sodium tartrate , Potassium thiocyanate , Salicylic acid , Silver nitrate , Small pumice pieces , Sodium carbonate , Sodium Chloride extra pure , Sodium hydroxide , Sodium thiosulphate pentahydrate , Starch , Sulphuric acid , Surgical gloves , Tartaric acid , Thioglycollic acid , Tissue roll , Trifluoracetic acid , Whatman Filter Paper , Wijs Iodine monochloride , Zinc acetate

Agarose, Low EEO,Ethanol,Choloroform,Isopropanol,Nuclease free water, 100mlx5,BSA,CTAB,Activated ch

Indian Council Of Forestry Research And Education (icfre)

SHIMLA, HIMACHAL PRADESHPosted 4 Feb

GEMGoods4 Documents

Category: Agarose, Low EEO , Ethanol , Choloroform , Isopropanol , Nuclease free water, 100mlx5 , BSA , CTAB , Activated charcoal , Sodium chloride , EDTA disodium , Go Taq G2 Green Master mix 100 rxn , Master mix 160 rxn , Glacial acetic acid , Acetone , Liquid Hand wash , Hi clean Solution , EDTA 0.5m for DNA isolation , Nitrile Gloves Medium size , Nitrile Gloves small size , Kim wipes , Tissue roll , Micro tips 0.2-10ul , PCR tubes 0.2 ml flat cap , Measuring cylinder 10ml , Mask , Round bottom Centrifuge tubes 15 ml , Round bottom Centrifuge tubes 50 ml , Mortor and Pestle 3 point 5 inch , Beaker 100 ml , Beaker 500 ml