Tris-HCl Molecular grade,Disodium EDTA Molecular Grade,Sodium citrate Molecular Grade,Tris Base Mol
Lala Ram Swarup Institute Of Tuberculosis And Respiratory Diseases
Progress
Quantity
64
Category
1 Primers
Bid Type
Two Packet Bid
Public procurement opportunity for Central Health Service Ministry Of Health And Family Welfare 1 Primers, 2 Primers, 3 Primers, 4 Primers, 5 Primers, 6 Primers, 7 Primers, 8 Primers, 9 Primers, 10 Primers, 11 Primers, 12 Primers, 13 Primers, 14 Primers, a Restriction Enzymes, b Restriction Enzymes, c Restriction Enzymes, d Restriction Enzymes, DNA Extraction Kit, Dream Taq green PCR Master Mix, 100bp DNA ladder, 50bp DNA ladder in NEW DELHI, DELHI. Quantity: 64 issued by. Submission Deadline: 26-07-2025 11: 00: 00. View full details and respond.
Main Document
BOQ
BOQ
ATC
OTHER
GEM_GENERAL_TERMS_AND_CONDITIONS
Lala Ram Swarup Institute Of Tuberculosis And Respiratory Diseases
Indian Council Of Agricultural Research (icar)
BANGALORE, KARNATAKA
All India Institute Of Medical Sciences (aiims)
SOUTH DELHI, DELHI
Central Silk Board
MURSHIDABAD, WEST BENGAL
Indian Council Of Agricultural Research (icar)
BANGALORE, KARNATAKA
Tender Results
Loading results...
| Item # | Title | Description | Quantity | Unit | Consignee | Delivery (Days) |
|---|---|---|---|---|---|---|
| 1 | 1 Primers | Forward CCCCTAGATGGGGGAACAGA 20bp | 1 | nos | storeslabchem.vmmc | 30 |
| 2 | 2 Primers | REVERSE GCATTGTTCTCGGGTGCAAG 20bp | 1 | nos | storeslabchem.vmmc | 30 |
| 3 | 3 Primers | Forward AGGCAGATGGACCTGGATTTGA 22bp | 1 | nos | storeslabchem.vmmc | 30 |
| 4 | 4 Primers | REVERSE TGGCTTGCAAATAGACTCATCTCC 24bp | 1 | nos | storeslabchem.vmmc | 30 |
| 5 | 5 Primers | FORWARD GCCTGGCACATAGTAGGCCC | 1 | nos | storeslabchem.vmmc | 30 |
| 6 | 6 Primers | REVERSE CTTCCTAGCCAGCCGGCATC | 1 | nos | storeslabchem.vmmc | 30 |
| 7 | 7 Primers | FORWARD CTCCTGGAAGCTGATCTTAGG 21bp | 1 | nos | storeslabchem.vmmc | 30 |
| 8 | 8 Primers | REVERSE CCTCTCTCTATCTAGCTCCAGCC 21bp | 1 | nos | storeslabchem.vmmc | 30 |
| 9 | 9 Primers | Forward control GCCAAACACTTCGAGCAC 18bp | 1 | nos | storeslabchem.vmmc | 30 |
| 10 | 10 Primers | Reverse control CGGCTCCTGGATGGCCTCA 18bp | 1 | nos | storeslabchem.vmmc | 30 |
| 11 | 11 Primers | Forward specific CAGAGCATGGACAGGGAGCAAG 22bp | 1 | nos | storeslabchem.vmmc | 30 |
| 12 | 12 Primers | Reverse specific TGCAGGACGCCGCGCTGATC 20bp | 1 | nos | storeslabchem.vmmc | 30 |
| 13 | 13 Primers | Forward ACAAGGGGCGTTAGCTTCAT 20bp | 1 | nos | storeslabchem.vmmc | 30 |
| 14 | 14 Primers | Reverse GGTATCACCGGTCAGCAGTC 20bp | 1 | nos | storeslabchem.vmmc | 30 |
| 15 | a Restriction Enzymes | Restriction Enzymes catalog R0585L Blp 1 2500units | 2 | nos | storeslabchem.vmmc | 30 |
| 16 | b Restriction Enzymes | Restriction Enzymes catalog R0149S Fast digest Taq 1 4000 Units | 2 | nos | storeslabchem.vmmc | 30 |
| 17 | c Restriction Enzymes | Restriction enzyme catalog R3505L Eag 1 High Fidelity 2500 Units | 2 | nos | storeslabchem.vmmc | 30 |
| 18 | d Restriction Enzymes | Restricted Enzymes catalog R3505L Drd 1 1500 units | 2 | nos | storeslabchem.vmmc | 30 |
| 19 | DNA Extraction Kit | DNA Extraction Kit for Human blood samples spin column based 250 PREP | 10 | kits | storeslabchem.vmmc | 30 |
| 20 | Dream Taq green PCR Master Mix | Dream Taq green PCR Master Mix 2x 100 RXN | 20 | kits | storeslabchem.vmmc | 30 |
| 21 | 100bp DNA ladder | DNA Ladder 100bp 1x50ug with loading dye ready to use | 6 | nos | storeslabchem.vmmc | 30 |
| 22 | 50bp DNA ladder | DNA Ladder 50bp 1x50ug with loading dye ready to use | 6 | nos | storeslabchem.vmmc | 30 |
Discover companies most likely to bid on this tender
Experience Criteria
Past Performance
Bidder Turnover
Certificate (Requested in ATC)
OEM Authorization Certificate
OEM Annual Turnover
Compliance of BoQ specification and supporting document *In case any bidder is seeking exemption from Experience / Turnover Criteria
the supporting documents to prove his eligibility for exemption must be uploaded for evaluation by the buyer
Sign up now to access all documents
Main Document
BOQ
BOQ
ATC
OTHER
GEM_GENERAL_TERMS_AND_CONDITIONS