TenderDekho Logo
GEM

Bids are Invited For Potassium hydroxide 1000 g,4 percent Paraformaldehyde 500 ml,Phenol chloroform isoamyl alcohol 300 in KANGRA, HIMACHAL PRADESH

Bid Publish Date

26-Mar-2025, 3:38 pm

Bid End Date

16-Apr-2025, 4:00 pm

Progress

Issue26-Mar-2025, 3:38 pm
Technical15-04-2025 12:29:01
Financial
Award11-Jul-2025, 12:54 am
Explore all 5 tabs to view complete tender details

Quantity

93

Category

Potassium hydroxide 1000 g

Bid Type

Two Packet Bid

Categories 39

Central University Of Himachal Pradesh announces a tender for Potassium hydroxide 1000 g, 4 percent Paraformaldehyde 500 ml, Phenol chloroform isoamyl alcohol 300 ml, Sodium carbonate 500 g, Thiobarbituric acid 125 g, Sodium hydroxide 1000 g, Superoxide Dismutase antioxidant assay kit calorimetric 1, Riboflavin 100 g, Trypan Blue zero point four percent Solution 50 ml, Guaiacol 250 g, Iron chloride FeCl3 100 g, Potassium Ferricyanide 100 g, Iodine 100 g, Dichloromethane 100 ml, Iron sulfate FeSO4 500 g, Sodium Hypochlorite NaOCl 500 ml, Perchloric Acid HClO4 500 ml, Zinc Chloride ZnCl2 500 g, Sodium Iodide NaI 500 g, Phosphate Buffer 500 ml, DNA Extraction Kit for Animal tissue 2, PCR kit 2, PBS Phosphate buffered saline 1000 ml, Sodium Chloride 1000 g, Bouins fixative 500 ml, Bradford reagent 1000 ml, ALT Activity kit Calorimetric 50 rxn, AST Activity kit Calorimetric 50 rxn, ALP Activity kit Calorimetric 50 rxn, Giemsa stain 50 ml, Ethanol 15 L, Nitroblue tetrazolium NBT 25 g, S Acetylthiocholine iodide 25 g, Potassium cyanide 500 g, Drabkins reagent 500 ml, Hayemis RBC diluting fluid 100 ml, Turks WBC diluting fluid 100 ml, Heparin anticoagulant 50 ml, Hydrogen peroxide 1500 ml, 1 Chloro2 4 Dinitrobenzene CDNB AR 100 g, Glutathione Reduced GSH 25 g, Two point five percent Glutaraldehyde 500 ml, Diethyl ether AR 1000 ml, Petroleum ether AR grade 2500 ml, Pyrogallol 100 g, Nitric acid 1000 ml, Perchloric acid 1000 ml, Glacial acetic acid 1500 ml, L tryptophan extrapure 100 mg, Barium chloride dehydrate 500 g, Gum acacia 500 g, Magnesium chloride hexahydrate 500 g, Potassium nitrate 500 g, Methyl cellosolve 1000 ml, Citric acid 500 g, Sodium citrate tribasic dehydrate extrapure 98 percent 500 g, Anthrone ACS 98 percent 25 g, N propanol 1000 ml, Ammonium metavanadate 100 g, Phenol crystalline extrapure AR 500 g, Boric acid 500 g, Papain 100 g, Ferric chloride hexahydrate A 100 g, Starch 1000 g, Donepezil hydrochloride 1, Master mix PCR 100 rxn, DPPH 2 g, ATBS 5 g, CTAB 3 kit, Mcnkey broth 500 g, MHA muller hinton broth 500 g, Sterile disc 2 pack, Plate count agar 500 g, M17 agar 500 g, M17 broth 500 g, Ox bile Ox gall 500 g, MHA agar 500 g, MRS broth 1000 g, MRS agar 1000 g, Pepsin and cysteine 25 g each, X gal 5 bromo 4 chloro 3 indolyl beta D galactopyranoside 1 g, 10 micro leter IPTG iso propylthio beta D galactopyranoside 5 g, Columbia agar 500 g, DNA extraction kit for bacteria 1 pack, Molecular primer 27F 5AGAGTTTGATCCTGGCTCAG 3 and 1492R 5 TACGGTACCTTGTTACGACTT3, Wurster reagent N N N N tetramethyl pphenylenediamine 10 g, Sucrose lactose maltose glucose fructose xylose sorbitol 500 g each, D Arabinose 100 g, D Reffinose 100 g, Gram staining kit 200 ml reagents, Trypsin 10 g, Nutrient Agar 500 g, Nutrient Broth 500 g in KANGRA, HIMACHAL PRADESH. Quantity: 93. Submission Deadline: 16-04-2025 16: 00: 00. Last date to apply is approaching fast!

Documents 4

GeM-Bidding-7683330.pdf

Main Document

BOQ Document

BOQ

BOQ Document

BOQ

GEM General Terms and Conditions Document

GEM_GENERAL_TERMS_AND_CONDITIONS

Past Similar Tenders (Historical Results)

5 found

Coomassie Brilliant Blue G 250,Bovine serum albumin,Barium carbonate AR,tri-Sodium citrate,Nutrient

Indian Council Of Agricultural Research (icar)

Posted: 11 September 2025
Closed: 3 October 2025
GEM

ICAR DARE Brewers yeast and insect diet components tender 2025 - 72 items, 3.0 value

Indian Council Of Agricultural Research (icar)

Posted: 28 November 2025
Closed: 19 December 2025
GEM

Folin Ciocalteu reagent,D Fructose,D Fructose 1 6 diphosphate tetrasodium salt hydrate,Glacial acet

Indian Council Of Agricultural Research (icar)

CHATRA, JHARKHAND

Posted: 16 October 2025
Closed: 6 November 2025
GEM

Sodium tetraborate,Trizma hydrochloride,Tetraethyl orthosilicate,D plus Glucuronolactone,Sodium met

Indian Council Of Medical Research (icmr)

NORTH 24 PARGANAS, WEST BENGAL

Posted: 2 April 2025
Closed: 23 April 2025
GEM

Potassium hydroxide,Sodium Sulphate,Ethanol marketed as diluent for DNA extraction,Hydrochloric aci

Zoological Survey Of India (zsi)

EAST KHASI HILLS, MEGHALAYA

Posted: 27 February 2025
Closed: 20 March 2025
GEM

Bill of Quantities (BOQ) 93 Items

Item # Title Description Quantity Unit Consignee Delivery (Days)
1 Potassium hydroxide 1000 g Strictly as per specifications 1 no [email protected] 30
2 4 percent Paraformaldehyde 500 ml Strictly as per specifications 1 no [email protected] 30
3 Phenol chloroform isoamyl alcohol 300 ml Strictly as per specifications 1 no [email protected] 30
4 Sodium carbonate 500 g Strictly as per specifications 1 no [email protected] 30
5 Thiobarbituric acid 125 g Strictly as per specifications 1 no [email protected] 30
6 Sodium hydroxide 1000 g Strictly as per specifications 1 no [email protected] 30
7 Superoxide Dismutase antioxidant assay kit calorimetric 1 Strictly as per specifications 1 no [email protected] 30
8 Riboflavin 100 g Strictly as per specifications 1 no [email protected] 30
9 Trypan Blue zero point four percent Solution 50 ml Strictly as per specifications 1 no [email protected] 30
10 Guaiacol 250 g Strictly as per specifications 1 no [email protected] 30
11 Iron chloride FeCl3 100 g Strictly as per specifications 1 no [email protected] 30
12 Potassium Ferricyanide 100 g Strictly as per specifications 1 no [email protected] 30
13 Iodine 100 g Strictly as per specifications 1 no [email protected] 30
14 Dichloromethane 100 ml Strictly as per specifications 1 no [email protected] 30
15 Iron sulfate FeSO4 500 g Strictly as per specifications 1 no [email protected] 30
16 Sodium Hypochlorite NaOCl 500 ml Strictly as per specifications 1 no [email protected] 30
17 Perchloric Acid HClO4 500 ml Strictly as per specifications 1 no [email protected] 30
18 Zinc Chloride ZnCl2 500 g Strictly as per specifications 1 no [email protected] 30
19 Sodium Iodide NaI 500 g Strictly as per specifications 1 no [email protected] 30
20 Phosphate Buffer 500 ml Strictly as per specifications 1 no [email protected] 30
21 DNA Extraction Kit for Animal tissue 2 Strictly as per specifications 1 no [email protected] 30
22 PCR kit 2 Strictly as per specifications 1 no [email protected] 30
23 PBS Phosphate buffered saline 1000 ml Strictly as per specifications 1 no [email protected] 30
24 Sodium Chloride 1000 g Strictly as per specifications 1 no [email protected] 30
25 Bouins fixative 500 ml Strictly as per specifications 1 no [email protected] 30
26 Bradford reagent 1000 ml Strictly as per specifications 1 no [email protected] 30
27 ALT Activity kit Calorimetric 50 rxn Strictly as per specifications 1 no [email protected] 30
28 AST Activity kit Calorimetric 50 rxn Strictly as per specifications 1 no [email protected] 30
29 ALP Activity kit Calorimetric 50 rxn Strictly as per specifications 1 no [email protected] 30
30 Giemsa stain 50 ml Strictly as per specifications 1 no [email protected] 30
31 Ethanol 15 L Strictly as per specifications 1 no [email protected] 30
32 Nitroblue tetrazolium NBT 25 g Strictly as per specifications 1 no [email protected] 30
33 S Acetylthiocholine iodide 25 g Strictly as per specifications 1 no [email protected] 30
34 Potassium cyanide 500 g Strictly as per specifications 1 no [email protected] 30
35 Drabkins reagent 500 ml Strictly as per specifications 1 no [email protected] 30
36 Hayemis RBC diluting fluid 100 ml Strictly as per specifications 1 no [email protected] 30
37 Turks WBC diluting fluid 100 ml Strictly as per specifications 1 no [email protected] 30
38 Heparin anticoagulant 50 ml Strictly as per specifications 1 no [email protected] 30
39 Hydrogen peroxide 1500 ml Strictly as per specifications 1 no [email protected] 30
40 1 Chloro2 4 Dinitrobenzene CDNB AR 100 g Strictly as per specifications 1 no [email protected] 30
41 Glutathione Reduced GSH 25 g Strictly as per specifications 1 no [email protected] 30
42 Two point five percent Glutaraldehyde 500 ml Strictly as per specifications 1 no [email protected] 30
43 Diethyl ether AR 1000 ml Strictly as per specifications 1 no [email protected] 30
44 Petroleum ether AR grade 2500 ml Strictly as per specifications 1 no [email protected] 30
45 Pyrogallol 100 g Strictly as per specifications 1 no [email protected] 30
46 Nitric acid 1000 ml Strictly as per specifications 1 no [email protected] 30
47 Perchloric acid 1000 ml Strictly as per specifications 1 no [email protected] 30
48 Glacial acetic acid 1500 ml Strictly as per specifications 1 no [email protected] 30
49 L tryptophan extrapure 100 mg Strictly as per specifications 1 no [email protected] 30
50 Barium chloride dehydrate 500 g Strictly as per specifications 1 no [email protected] 30
51 Gum acacia 500 g Strictly as per specifications 1 no [email protected] 30
52 Magnesium chloride hexahydrate 500 g Strictly as per specifications 1 no [email protected] 30
53 Potassium nitrate 500 g Strictly as per specifications 1 no [email protected] 30
54 Methyl cellosolve 1000 ml Strictly as per specifications 1 no [email protected] 30
55 Citric acid 500 g Strictly as per specifications 1 no [email protected] 30
56 Sodium citrate tribasic dehydrate extrapure 98 percent 500 g Strictly as per specifications 1 no [email protected] 30
57 Anthrone ACS 98 percent 25 g Strictly as per specifications 1 no [email protected] 30
58 N propanol 1000 ml Strictly as per specifications 1 no [email protected] 30
59 Ammonium metavanadate 100 g Strictly as per specifications 1 no [email protected] 30
60 Phenol crystalline extrapure AR 500 g Strictly as per specifications 1 no [email protected] 30
61 Boric acid 500 g Strictly as per specifications 1 no [email protected] 30
62 Papain 100 g Strictly as per specifications 1 no [email protected] 30
63 Ferric chloride hexahydrate A 100 g Strictly as per specifications 1 no [email protected] 30
64 Starch 1000 g Strictly as per specifications 1 no [email protected] 30
65 Donepezil hydrochloride 1 Strictly as per specifications 1 no [email protected] 30
66 Master mix PCR 100 rxn Strictly as per specifications 1 no [email protected] 30
67 DPPH 2 g Strictly as per specifications 1 no [email protected] 30
68 ATBS 5 g Strictly as per specifications 1 no [email protected] 30
69 CTAB 3 kit Strictly as per specifications 1 no [email protected] 30
70 Mcnkey broth 500 g Strictly as per specifications 1 no [email protected] 30
71 MHA muller hinton broth 500 g Strictly as per specifications 1 no [email protected] 30
72 Sterile disc 2 pack Strictly as per specifications 1 no [email protected] 30
73 Plate count agar 500 g Strictly as per specifications 1 no [email protected] 30
74 M17 agar 500 g Strictly as per specifications 1 no [email protected] 30
75 M17 broth 500 g Strictly as per specifications 1 no [email protected] 30
76 Ox bile Ox gall 500 g Strictly as per specifications 1 no [email protected] 30
77 MHA agar 500 g Strictly as per specifications 1 no [email protected] 30
78 MRS broth 1000 g Strictly as per specifications 1 no [email protected] 30
79 MRS agar 1000 g Strictly as per specifications 1 no [email protected] 30
80 Pepsin and cysteine 25 g each Strictly as per specifications 1 no [email protected] 30
81 X gal 5 bromo 4 chloro 3 indolyl beta D galactopyranoside 1 g Strictly as per specifications 1 no [email protected] 30
82 10 micro leter IPTG iso propylthio beta D galactopyranoside 5 g Strictly as per specifications 1 no [email protected] 30
83 Columbia agar 500 g Strictly as per specifications 1 no [email protected] 30
84 DNA extraction kit for bacteria 1 pack Strictly as per specifications 1 no [email protected] 30
85 Molecular primer 27F 5AGAGTTTGATCCTGGCTCAG 3 and 1492R 5 TACGGTACCTTGTTACGACTT3 Strictly as per specifications 1 no [email protected] 30
86 Wurster reagent N N N N tetramethyl pphenylenediamine 10 g Strictly as per specifications 1 no [email protected] 30
87 Sucrose lactose maltose glucose fructose xylose sorbitol 500 g each Strictly as per specifications 1 no [email protected] 30
88 D Arabinose 100 g Strictly as per specifications 1 no [email protected] 30
89 D Reffinose 100 g Strictly as per specifications 1 no [email protected] 30
90 Gram staining kit 200 ml reagents Strictly as per specifications 1 no [email protected] 30
91 Trypsin 10 g Strictly as per specifications 1 no [email protected] 30
92 Nutrient Agar 500 g Strictly as per specifications 1 no [email protected] 30
93 Nutrient Broth 500 g Strictly as per specifications 1 no [email protected] 30

Technical Results

S.No Seller Item Date Status
1ADCO LAB SOLUTION   Under PMA-15-04-2025 12:29:01Disqualified
2AMBIKA SCIENTIFIC TRADERS   Under PMA-16-04-2025 15:50:09Qualified
3AVAIN LABS INTERNATIONAL   Under PMA-16-04-2025 15:59:09Disqualified
4DEEP DISTRIBUTORS   Under PMA-16-04-2025 14:38:15Qualified
5MAHAVIR SURGICAL & Chemicals   Under PMA-15-04-2025 19:18:44Qualified
6RAM TRADERS   Under PMA-03-04-2025 17:19:08Disqualified
7SUPERWORTH BIODISCOVERIES PRIVATE LIMITED   Under PMA-16-04-2025 12:44:34Disqualified

Financial Results

Rank Seller Price Item
L1DEEP DISTRIBUTORS(MSE,MII)( MSE Social Category:General )    Under PMA₹2,68,586Item Categories : Potassium hydroxide 1000 g,4 percent Paraformaldehyde 500 ml,Phenol chloroform isoamyl alcohol 300
L2MAHAVIR SURGICAL & Chemicals (MSE,MII)( MSE Social Category:General )    Under PMA₹3,62,595Item Categories : Potassium hydroxide 1000 g,4 percent Paraformaldehyde 500 ml,Phenol chloroform isoamyl alcohol 300
L3AMBIKA SCIENTIFIC TRADERS (MSE)( MSE Social Category:General )    Under PMA₹6,18,361Item Categories : Potassium hydroxide 1000 g,4 percent Paraformaldehyde 500 ml,Phenol chloroform isoamyl alcohol 300

Contract / Result Documents 1

Please sign in or create an account to view contract details and download result documents.

Frequently Asked Questions

Key insights about HIMACHAL PRADESH tender market

What are the eligibility requirements for participating in the tender?

The eligibility requirements for this tender include being a registered entity capable of supplying laboratory-grade chemicals, holding valid certifications that prove compliance with quality and safety standards, and demonstrating prior experience in delivering such supplies to educational institutions.

What certificates are required for this tender?

Bidders must provide several required certificates during the tender submission, including registration and compliance certificates that showcase adherence to national safety regulations. Quality certifications for each chemical proposed for delivery should also be included.

How is the registration process managed for this tender?

The registration process requires bidders to register with the relevant authority and present all necessary documentation that meets the eligibility criteria. Interested parties must ensure their bidding documents are accurately filled and submitted within the prescribed format.

What are the performance security requirements for bidders?

The performance security requirements for successful bidders are mandated to ensure compliance with the contract terms. A certain percentage of the contract value may need to be deposited as security, which ensures that the supplier fulfills their obligations to deliver quality products on time.

Are there any benefits for Micro, Small, and Medium Enterprises (MSEs) participating in this tender?

Yes, MSEs stand to gain significant advantages when participating in this tender, including relaxed qualification norms, evaluation preferences, and encouragement under government policies aimed at promoting local businesses. This initiative aims to foster an inclusive procurement environment for budding enterprises.