TenderDekho Logo
Closed GEM

Bids are Invited For Potassium hydroxide 1000 g,4 percent Paraformaldehyde 500 ml,Phenol chloroform isoamyl alcohol 300 in KANGRA, HIMACHAL PRADESH

Bid Publish Date

26-Mar-2025, 3:38 pm

Bid End Date

16-Apr-2025, 4:00 pm

Progress

Issue26-Mar-2025, 3:38 pm
Technical15-04-2025 12:29:01
Financial
Award11-Jul-2025, 12:54 am
Explore all 5 tabs to view complete tender details

Quantity

93

Category

Potassium hydroxide 1000 g

Bid Type

Two Packet Bid

Categories 39

Central University Of Himachal Pradesh announces a tender for Potassium hydroxide 1000 g, 4 percent Paraformaldehyde 500 ml, Phenol chloroform isoamyl alcohol 300 ml, Sodium carbonate 500 g, Thiobarbituric acid 125 g, Sodium hydroxide 1000 g, Superoxide Dismutase antioxidant assay kit calorimetric 1, Riboflavin 100 g, Trypan Blue zero point four percent Solution 50 ml, Guaiacol 250 g, Iron chloride FeCl3 100 g, Potassium Ferricyanide 100 g, Iodine 100 g, Dichloromethane 100 ml, Iron sulfate FeSO4 500 g, Sodium Hypochlorite NaOCl 500 ml, Perchloric Acid HClO4 500 ml, Zinc Chloride ZnCl2 500 g, Sodium Iodide NaI 500 g, Phosphate Buffer 500 ml, DNA Extraction Kit for Animal tissue 2, PCR kit 2, PBS Phosphate buffered saline 1000 ml, Sodium Chloride 1000 g, Bouins fixative 500 ml, Bradford reagent 1000 ml, ALT Activity kit Calorimetric 50 rxn, AST Activity kit Calorimetric 50 rxn, ALP Activity kit Calorimetric 50 rxn, Giemsa stain 50 ml, Ethanol 15 L, Nitroblue tetrazolium NBT 25 g, S Acetylthiocholine iodide 25 g, Potassium cyanide 500 g, Drabkins reagent 500 ml, Hayemis RBC diluting fluid 100 ml, Turks WBC diluting fluid 100 ml, Heparin anticoagulant 50 ml, Hydrogen peroxide 1500 ml, 1 Chloro2 4 Dinitrobenzene CDNB AR 100 g, Glutathione Reduced GSH 25 g, Two point five percent Glutaraldehyde 500 ml, Diethyl ether AR 1000 ml, Petroleum ether AR grade 2500 ml, Pyrogallol 100 g, Nitric acid 1000 ml, Perchloric acid 1000 ml, Glacial acetic acid 1500 ml, L tryptophan extrapure 100 mg, Barium chloride dehydrate 500 g, Gum acacia 500 g, Magnesium chloride hexahydrate 500 g, Potassium nitrate 500 g, Methyl cellosolve 1000 ml, Citric acid 500 g, Sodium citrate tribasic dehydrate extrapure 98 percent 500 g, Anthrone ACS 98 percent 25 g, N propanol 1000 ml, Ammonium metavanadate 100 g, Phenol crystalline extrapure AR 500 g, Boric acid 500 g, Papain 100 g, Ferric chloride hexahydrate A 100 g, Starch 1000 g, Donepezil hydrochloride 1, Master mix PCR 100 rxn, DPPH 2 g, ATBS 5 g, CTAB 3 kit, Mcnkey broth 500 g, MHA muller hinton broth 500 g, Sterile disc 2 pack, Plate count agar 500 g, M17 agar 500 g, M17 broth 500 g, Ox bile Ox gall 500 g, MHA agar 500 g, MRS broth 1000 g, MRS agar 1000 g, Pepsin and cysteine 25 g each, X gal 5 bromo 4 chloro 3 indolyl beta D galactopyranoside 1 g, 10 micro leter IPTG iso propylthio beta D galactopyranoside 5 g, Columbia agar 500 g, DNA extraction kit for bacteria 1 pack, Molecular primer 27F 5AGAGTTTGATCCTGGCTCAG 3 and 1492R 5 TACGGTACCTTGTTACGACTT3, Wurster reagent N N N N tetramethyl pphenylenediamine 10 g, Sucrose lactose maltose glucose fructose xylose sorbitol 500 g each, D Arabinose 100 g, D Reffinose 100 g, Gram staining kit 200 ml reagents, Trypsin 10 g, Nutrient Agar 500 g, Nutrient Broth 500 g in KANGRA, HIMACHAL PRADESH. Quantity: 93. Submission Deadline: 16-04-2025 16: 00: 00. Last date to apply is approaching fast!

Additional Tender Data

Commercial Details

Tender Category

Goods

Bid To RA

No

Bid To RA Enabled

No

Item Category

Potassium hydroxide 1000 g , 4 percent Paraformaldehyde 500 ml , Phenol chloroform isoamyl alcohol 300 ml , Sodium carbonate 500 g , Thiobarbituric acid 125 g , Sodium hydroxide 1000 g , Superoxide Dismutase antioxidant assay kit calorimetric 1 , Riboflavin 100 g , Trypan Blue zero point four percent Solution 50 ml , Guaiacol 250 g , Iron chloride FeCl3 100 g , Potassium Ferricyanide 100 g , Iodine 100 g , Dichloromethane 100 ml , Iron sulfate FeSO4 500 g , Sodium Hypochlorite NaOCl 500 ml , Perchloric Acid HClO4 500 ml , Zinc Chloride ZnCl2 500 g , Sodium Iodide NaI 500 g , Phosphate Buffer 500 ml , DNA Extraction Kit for Animal tissue 2 , PCR kit 2 , PBS Phosphate buffered saline 1000 ml , Sodium Chloride 1000 g , Bouins fixative 500 ml , Bradford reagent 1000 ml , ALT Activity kit Calorimetric 50 rxn , AST Activity kit Calorimetric 50 rxn , ALP Activity kit Calorimetric 50 rxn , Giemsa stain 50 ml , Ethanol 15 L , Nitroblue tetrazolium NBT 25 g , S Acetylthiocholine iodide 25 g , Potassium cyanide 500 g , Drabkins reagent 500 ml , Hayemis RBC diluting fluid 100 ml , Turks WBC diluting fluid 100 ml , Heparin anticoagulant 50 ml , Hydrogen peroxide 1500 ml , 1 Chloro2 4 Dinitrobenzene CDNB AR 100 g , Glutathione Reduced GSH 25 g , Two point five percent Glutaraldehyde 500 ml , Diethyl ether AR 1000 ml , Petroleum ether AR grade 2500 ml , Pyrogallol 100 g , Nitric acid 1000 ml , Perchloric acid 1000 ml , Glacial acetic acid 1500 ml , L tryptophan extrapure 100 mg , Barium chloride dehydrate 500 g , Gum acacia 500 g , Magnesium chloride hexahydrate 500 g , Potassium nitrate 500 g , Methyl cellosolve 1000 ml , Citric acid 500 g , Sodium citrate tribasic dehydrate extrapure 98 percent 500 g , Anthrone ACS 98 percent 25 g , N propanol 1000 ml , Ammonium metavanadate 100 g , Phenol crystalline extrapure AR 500 g , Boric acid 500 g , Papain 100 g , Ferric chloride hexahydrate A 100 g , Starch 1000 g , Donepezil hydrochloride 1 , Master mix PCR 100 rxn , DPPH 2 g , ATBS 5 g , CTAB 3 kit , Mcnkey broth 500 g , MHA muller hinton broth 500 g , Sterile disc 2 pack , Plate count agar 500 g , M17 agar 500 g , M17 broth 500 g , Ox bile Ox gall 500 g , MHA agar 500 g , MRS broth 1000 g , MRS agar 1000 g , Pepsin and cysteine 25 g each , X gal 5 bromo 4 chloro 3 indolyl beta D galactopyranoside 1 g , 10 micro leter IPTG iso propylthio beta D galactopyranoside 5 g , Columbia agar 500 g , DNA extraction kit for bacteria 1 pack , Molecular primer 27F 5AGAGTTTGATCCTGGCTCAG 3 and 1492R 5 TACGGTACCTTGTTACGACTT3 , Wurster reagent N N N N tetramethyl pphenylenediamine 10 g , Sucrose lactose maltose glucose fructose xylose sorbitol 500 g each , D Arabinose 100 g , D Reffinose 100 g , Gram staining kit 200 ml reagents , Trypsin 10 g , Nutrient Agar 500 g , Nutrient Broth 500 g

Authority Records

MINISTRY OF EDUCATIONHIGHER EDUCATION DEPARTMENTCENTRAL UNIVERSITY OF HIMACHAL PRADESH

BID & GeM Expert Consultancy

End-to-end support — bid preparation, GeM registration, document filing & compliance by industry experts.

Bid Preparation GeM Registration Document Filing

Free consultation · 24h response

Documents 4

GeM-Bidding-7683330.pdf

Main Document

BOQ Document

BOQ

BOQ Document

BOQ

GEM General Terms and Conditions Document

GEM_GENERAL_TERMS_AND_CONDITIONS

Bill of Quantities (BOQ) 93 Items Sign in for GEM prices

#1

Potassium hydroxide 1000 g

Strictly as per specifications

1 no Delivery: 30 days
#2

4 percent Paraformaldehyde 500 ml

Strictly as per specifications

1 no Delivery: 30 days
#3

Phenol chloroform isoamyl alcohol 300 ml

Strictly as per specifications

1 no Delivery: 30 days
#4

Sodium carbonate 500 g

Strictly as per specifications

1 no Delivery: 30 days
#5

Thiobarbituric acid 125 g

Strictly as per specifications

1 no Delivery: 30 days
#6

Sodium hydroxide 1000 g

Strictly as per specifications

1 no Delivery: 30 days
#7

Superoxide Dismutase antioxidant assay kit calorimetric 1

Strictly as per specifications

1 no Delivery: 30 days
#8

Riboflavin 100 g

Strictly as per specifications

1 no Delivery: 30 days
#9

Trypan Blue zero point four percent Solution 50 ml

Strictly as per specifications

1 no Delivery: 30 days
#10

Guaiacol 250 g

Strictly as per specifications

1 no Delivery: 30 days
#11

Iron chloride FeCl3 100 g

Strictly as per specifications

1 no Delivery: 30 days
#12

Potassium Ferricyanide 100 g

Strictly as per specifications

1 no Delivery: 30 days
#13

Iodine 100 g

Strictly as per specifications

1 no Delivery: 30 days
#14

Dichloromethane 100 ml

Strictly as per specifications

1 no Delivery: 30 days
#15

Iron sulfate FeSO4 500 g

Strictly as per specifications

1 no Delivery: 30 days
#16

Sodium Hypochlorite NaOCl 500 ml

Strictly as per specifications

1 no Delivery: 30 days
#17

Perchloric Acid HClO4 500 ml

Strictly as per specifications

1 no Delivery: 30 days
#18

Zinc Chloride ZnCl2 500 g

Strictly as per specifications

1 no Delivery: 30 days
#19

Sodium Iodide NaI 500 g

Strictly as per specifications

1 no Delivery: 30 days
#20

Phosphate Buffer 500 ml

Strictly as per specifications

1 no Delivery: 30 days
#21

DNA Extraction Kit for Animal tissue 2

Strictly as per specifications

1 no Delivery: 30 days
#22

PCR kit 2

Strictly as per specifications

1 no Delivery: 30 days
#23

PBS Phosphate buffered saline 1000 ml

Strictly as per specifications

1 no Delivery: 30 days
#24

Sodium Chloride 1000 g

Strictly as per specifications

1 no Delivery: 30 days
#25

Bouins fixative 500 ml

Strictly as per specifications

1 no Delivery: 30 days
#26

Bradford reagent 1000 ml

Strictly as per specifications

1 no Delivery: 30 days
#27

ALT Activity kit Calorimetric 50 rxn

Strictly as per specifications

1 no Delivery: 30 days
#28

AST Activity kit Calorimetric 50 rxn

Strictly as per specifications

1 no Delivery: 30 days
#29

ALP Activity kit Calorimetric 50 rxn

Strictly as per specifications

1 no Delivery: 30 days
#30

Giemsa stain 50 ml

Strictly as per specifications

1 no Delivery: 30 days
#31

Ethanol 15 L

Strictly as per specifications

1 no Delivery: 30 days
#32

Nitroblue tetrazolium NBT 25 g

Strictly as per specifications

1 no Delivery: 30 days
#33

S Acetylthiocholine iodide 25 g

Strictly as per specifications

1 no Delivery: 30 days
#34

Potassium cyanide 500 g

Strictly as per specifications

1 no Delivery: 30 days
#35

Drabkins reagent 500 ml

Strictly as per specifications

1 no Delivery: 30 days
#36

Hayemis RBC diluting fluid 100 ml

Strictly as per specifications

1 no Delivery: 30 days
#37

Turks WBC diluting fluid 100 ml

Strictly as per specifications

1 no Delivery: 30 days
#38

Heparin anticoagulant 50 ml

Strictly as per specifications

1 no Delivery: 30 days
#39

Hydrogen peroxide 1500 ml

Strictly as per specifications

1 no Delivery: 30 days
#40

1 Chloro2 4 Dinitrobenzene CDNB AR 100 g

Strictly as per specifications

1 no Delivery: 30 days
#41

Glutathione Reduced GSH 25 g

Strictly as per specifications

1 no Delivery: 30 days
#42

Two point five percent Glutaraldehyde 500 ml

Strictly as per specifications

1 no Delivery: 30 days
#43

Diethyl ether AR 1000 ml

Strictly as per specifications

1 no Delivery: 30 days
#44

Petroleum ether AR grade 2500 ml

Strictly as per specifications

1 no Delivery: 30 days
#45

Pyrogallol 100 g

Strictly as per specifications

1 no Delivery: 30 days
#46

Nitric acid 1000 ml

Strictly as per specifications

1 no Delivery: 30 days
#47

Perchloric acid 1000 ml

Strictly as per specifications

1 no Delivery: 30 days
#48

Glacial acetic acid 1500 ml

Strictly as per specifications

1 no Delivery: 30 days
#49

L tryptophan extrapure 100 mg

Strictly as per specifications

1 no Delivery: 30 days
#50

Barium chloride dehydrate 500 g

Strictly as per specifications

1 no Delivery: 30 days
#51

Gum acacia 500 g

Strictly as per specifications

1 no Delivery: 30 days
#52

Magnesium chloride hexahydrate 500 g

Strictly as per specifications

1 no Delivery: 30 days
#53

Potassium nitrate 500 g

Strictly as per specifications

1 no Delivery: 30 days
#54

Methyl cellosolve 1000 ml

Strictly as per specifications

1 no Delivery: 30 days
#55

Citric acid 500 g

Strictly as per specifications

1 no Delivery: 30 days
#56

Sodium citrate tribasic dehydrate extrapure 98 percent 500 g

Strictly as per specifications

1 no Delivery: 30 days
#57

Anthrone ACS 98 percent 25 g

Strictly as per specifications

1 no Delivery: 30 days
#58

N propanol 1000 ml

Strictly as per specifications

1 no Delivery: 30 days
#59

Ammonium metavanadate 100 g

Strictly as per specifications

1 no Delivery: 30 days
#60

Phenol crystalline extrapure AR 500 g

Strictly as per specifications

1 no Delivery: 30 days
#61

Boric acid 500 g

Strictly as per specifications

1 no Delivery: 30 days
#62

Papain 100 g

Strictly as per specifications

1 no Delivery: 30 days
#63

Ferric chloride hexahydrate A 100 g

Strictly as per specifications

1 no Delivery: 30 days
#64

Starch 1000 g

Strictly as per specifications

1 no Delivery: 30 days
#65

Donepezil hydrochloride 1

Strictly as per specifications

1 no Delivery: 30 days
#66

Master mix PCR 100 rxn

Strictly as per specifications

1 no Delivery: 30 days
#67

DPPH 2 g

Strictly as per specifications

1 no Delivery: 30 days
#68

ATBS 5 g

Strictly as per specifications

1 no Delivery: 30 days
#69

CTAB 3 kit

Strictly as per specifications

1 no Delivery: 30 days
#70

Mcnkey broth 500 g

Strictly as per specifications

1 no Delivery: 30 days
#71

MHA muller hinton broth 500 g

Strictly as per specifications

1 no Delivery: 30 days
#72

Sterile disc 2 pack

Strictly as per specifications

1 no Delivery: 30 days
#73

Plate count agar 500 g

Strictly as per specifications

1 no Delivery: 30 days
#74

M17 agar 500 g

Strictly as per specifications

1 no Delivery: 30 days
#75

M17 broth 500 g

Strictly as per specifications

1 no Delivery: 30 days
#76

Ox bile Ox gall 500 g

Strictly as per specifications

1 no Delivery: 30 days
#77

MHA agar 500 g

Strictly as per specifications

1 no Delivery: 30 days
#78

MRS broth 1000 g

Strictly as per specifications

1 no Delivery: 30 days
#79

MRS agar 1000 g

Strictly as per specifications

1 no Delivery: 30 days
#80

Pepsin and cysteine 25 g each

Strictly as per specifications

1 no Delivery: 30 days
#81

X gal 5 bromo 4 chloro 3 indolyl beta D galactopyranoside 1 g

Strictly as per specifications

1 no Delivery: 30 days
#82

10 micro leter IPTG iso propylthio beta D galactopyranoside 5 g

Strictly as per specifications

1 no Delivery: 30 days
#83

Columbia agar 500 g

Strictly as per specifications

1 no Delivery: 30 days
#84

DNA extraction kit for bacteria 1 pack

Strictly as per specifications

1 no Delivery: 30 days
#85

Molecular primer 27F 5AGAGTTTGATCCTGGCTCAG 3 and 1492R 5 TACGGTACCTTGTTACGACTT3

Strictly as per specifications

1 no Delivery: 30 days
#86

Wurster reagent N N N N tetramethyl pphenylenediamine 10 g

Strictly as per specifications

1 no Delivery: 30 days
#87

Sucrose lactose maltose glucose fructose xylose sorbitol 500 g each

Strictly as per specifications

1 no Delivery: 30 days
#88

D Arabinose 100 g

Strictly as per specifications

1 no Delivery: 30 days
#89

D Reffinose 100 g

Strictly as per specifications

1 no Delivery: 30 days
#90

Gram staining kit 200 ml reagents

Strictly as per specifications

1 no Delivery: 30 days
#91

Trypsin 10 g

Strictly as per specifications

1 no Delivery: 30 days
#92

Nutrient Agar 500 g

Strictly as per specifications

1 no Delivery: 30 days
#93

Nutrient Broth 500 g

Strictly as per specifications

1 no Delivery: 30 days

Technical Results

S.No Seller Item Date Status
1
ADCO LAB SOLUTION   Under PMA
-15-04-2025 12:29:01
2
AMBIKA SCIENTIFIC TRADERS   Under PMA
-16-04-2025 15:50:09
3
AVAIN LABS INTERNATIONAL   Under PMA
-16-04-2025 15:59:09
4
DEEP DISTRIBUTORS   Under PMA
-16-04-2025 14:38:15
5
MAHAVIR SURGICAL & Chemicals   Under PMA
-15-04-2025 19:18:44
6
RAM TRADERS   Under PMA
-03-04-2025 17:19:08
7
SUPERWORTH BIODISCOVERIES PRIVATE LIMITED   Under PMA
-16-04-2025 12:44:34

Financial Results

Rank Seller Price Item
L1
DEEP DISTRIBUTORS(MSE,MII)( MSE Social Category:General )    Under PMA
Item Categories : Potassium hydroxide 1000 g,4 percent Paraformaldehyde 500 ml,Phenol chloroform isoamyl alcohol 300
L2
MAHAVIR SURGICAL & Chemicals (MSE,MII)( MSE Social Category:General )    Under PMA
Item Categories : Potassium hydroxide 1000 g,4 percent Paraformaldehyde 500 ml,Phenol chloroform isoamyl alcohol 300
L3
AMBIKA SCIENTIFIC TRADERS (MSE)( MSE Social Category:General )    Under PMA
Item Categories : Potassium hydroxide 1000 g,4 percent Paraformaldehyde 500 ml,Phenol chloroform isoamyl alcohol 300

Contract / Result Documents 1

Please sign in or create an account to view contract details and download result documents.

Frequently Asked Questions

Key insights about HIMACHAL PRADESH tender market

What are the eligibility requirements for participating in the tender?

The eligibility requirements for this tender include being a registered entity capable of supplying laboratory-grade chemicals, holding valid certifications that prove compliance with quality and safety standards, and demonstrating prior experience in delivering such supplies to educational institutions.

What certificates are required for this tender?

Bidders must provide several required certificates during the tender submission, including registration and compliance certificates that showcase adherence to national safety regulations. Quality certifications for each chemical proposed for delivery should also be included.

How is the registration process managed for this tender?

The registration process requires bidders to register with the relevant authority and present all necessary documentation that meets the eligibility criteria. Interested parties must ensure their bidding documents are accurately filled and submitted within the prescribed format.

What are the performance security requirements for bidders?

The performance security requirements for successful bidders are mandated to ensure compliance with the contract terms. A certain percentage of the contract value may need to be deposited as security, which ensures that the supplier fulfills their obligations to deliver quality products on time.

Are there any benefits for Micro, Small, and Medium Enterprises (MSEs) participating in this tender?

Yes, MSEs stand to gain significant advantages when participating in this tender, including relaxed qualification norms, evaluation preferences, and encouragement under government policies aimed at promoting local businesses. This initiative aims to foster an inclusive procurement environment for budding enterprises.