Seakem LE Agarose,100bp DNA Ladder RTU Ready to Use,50bp DNA Ladder RTU Ready to Use,Micro tips 1 t
Indian Council Of Agricultural Research (icar)
BANGALORE, KARNATAKA
Progress
RAQuantity
64
Category
1 Primers
Bid Type
Two Packet Bid
Central Health Service Ministry Of Health And Family Welfare announces a tender for 1 Primers, 2 Primers, 3 Primers, 4 Primers, 5 Primers, 6 Primers, 7 Primers, 8 Primers, 9 Primers, 10 Primers, 11 Primers, 12 Primers, 13 Primers, 14 Primers, a Restriction Enzymes, b Restriction Enzymes, c Restriction Enzymes, d Restriction Enzymes, DNA Extraction Kit, Dream Taq green PCR Master Mix, 100bp DNA ladder, 50bp DNA ladder in NEW DELHI, DELHI. Quantity: 64. Submission Deadline: 18-11-2025 14: 00: 00. Last date to apply is approaching fast!
Main Document
BOQ
BOQ
OTHER
ATC
GEM_GENERAL_TERMS_AND_CONDITIONS
Indian Council Of Agricultural Research (icar)
BANGALORE, KARNATAKA
All India Institute Of Medical Sciences (aiims)
SOUTH DELHI, DELHI
Central Silk Board
MURSHIDABAD, WEST BENGAL
Indian Council Of Agricultural Research (icar)
BANGALORE, KARNATAKA
Indian Council Of Agricultural Research (icar)
BHARATPUR, RAJASTHAN
Tender Results
Loading results...
| Item # | Title | Description | Quantity | Unit | Consignee | Delivery (Days) |
|---|---|---|---|---|---|---|
| 1 | 1 Primers | Forward CCCCTAGATGGGGGAACAGA 20bp | 1 | nos | storeslabchem.vmmc | 30 |
| 2 | 2 Primers | REVERSE GCATTGTTCTCGGGTGCAAG 20bp | 1 | nos | storeslabchem.vmmc | 30 |
| 3 | 3 Primers | Forward AGGCAGATGGACCTGGATTTGA 22bp | 1 | nos | storeslabchem.vmmc | 30 |
| 4 | 4 Primers | REVERSE TGGCTTGCAAATAGACTCATCTCC 24bp | 1 | nos | storeslabchem.vmmc | 30 |
| 5 | 5 Primers | FORWARD GCCTGGCACATAGTAGGCCC | 1 | nos | storeslabchem.vmmc | 30 |
| 6 | 6 Primers | REVERSE CTTCCTAGCCAGCCGGCATC | 1 | nos | storeslabchem.vmmc | 30 |
| 7 | 7 Primers | FORWARD CTCCTGGAAGCTGATCTTAGG 21bp | 1 | nos | storeslabchem.vmmc | 30 |
| 8 | 8 Primers | REVERSE CCTCTCTCTATCTAGCTCCAGCC 21bp | 1 | nos | storeslabchem.vmmc | 30 |
| 9 | 9 Primers | Forward control GCCAAACACTTCGAGCAC 18bp | 1 | nos | storeslabchem.vmmc | 30 |
| 10 | 10 Primers | Reverse control CGGCTCCTGGATGGCCTCA 18bp | 1 | nos | storeslabchem.vmmc | 30 |
| 11 | 11 Primers | Forward specific CAGAGCATGGACAGGGAGCAAG 22bp | 1 | nos | storeslabchem.vmmc | 30 |
| 12 | 12 Primers | Reverse specific TGCAGGACGCCGCGCTGATC 20bp | 1 | nos | storeslabchem.vmmc | 30 |
| 13 | 13 Primers | Forward ACAAGGGGCGTTAGCTTCAT 20bp | 1 | nos | storeslabchem.vmmc | 30 |
| 14 | 14 Primers | Reverse GGTATCACCGGTCAGCAGTC 20bp | 1 | nos | storeslabchem.vmmc | 30 |
| 15 | a Restriction Enzymes | Restriction Enzymes catalog R0585L Blp 1 2500units | 2 | nos | storeslabchem.vmmc | 30 |
| 16 | b Restriction Enzymes | Restriction Enzymes catalog R0149S Fast digest Taq 1 4000 Units | 2 | nos | storeslabchem.vmmc | 30 |
| 17 | c Restriction Enzymes | Restriction enzyme catalog R3505L Eag 1 High Fidelity 2500 Units | 2 | nos | storeslabchem.vmmc | 30 |
| 18 | d Restriction Enzymes | Restricted Enzymes catalog R3505L Drd 1 1500 units | 2 | nos | storeslabchem.vmmc | 30 |
| 19 | DNA Extraction Kit | DNA Extraction Kit for Human blood samples spin column based 250 PREP | 10 | kits | storeslabchem.vmmc | 30 |
| 20 | Dream Taq green PCR Master Mix | Dream Taq green PCR Master Mix 2x 100 RXN | 20 | kits | storeslabchem.vmmc | 30 |
| 21 | 100bp DNA ladder | DNA Ladder 100bp 1x50ug with loading dye ready to use | 6 | nos | storeslabchem.vmmc | 30 |
| 22 | 50bp DNA ladder | DNA Ladder 50bp 1x50ug with loading dye ready to use | 6 | nos | storeslabchem.vmmc | 30 |
Experience Criteria
Past Performance
Bidder Turnover
Certificate (Requested in ATC)
OEM Authorization Certificate
OEM Annual Turnover *In case any bidder is seeking exemption from Experience / Turnover Criteria
the supporting documents to prove his eligibility for exemption must be uploaded for evaluation by the buyer
Start
02-Jan-2026, 2:00 pm
End
03-Jan-2026, 2:00 pm
Duration: 24 hours
Reverse Auction Document
✅ RA concluded. Check financial results for final rankings.
These are the final prices after the reverse auction event. Prices may be lower than initial bids.
| Rank | Seller | Final Price | Item |
|---|---|---|---|
| L1 | bio sphere(MSE,MII) Under PMA Winner | ₹7,62,397 | Item Categories : 1 Primers,2 Primers,3 Primers,4 Primers,5 Primers,6 Primers,7 Primers,8 Primers,9 Primers,10 Primer |
| L2 | J P ENTERPRISES (MII) Under PMA | ₹28,19,678 | Item Categories : 1 Primers,2 Primers,3 Primers,4 Primers,5 Primers,6 Primers,7 Primers,8 Primers,9 Primers,10 Primer |
🎉 L1 Winner
bio sphere(MSE,MII) Under PMA
Final Price: ₹7,62,397
Please sign in or create an account to view contract details and download result documents.
Sign up now to access all documents
Main Document
BOQ
BOQ
OTHER
ATC
GEM_GENERAL_TERMS_AND_CONDITIONS