GEM

Tender Notice for 1 Primers,2 Primers,3 Primers,4 Primers,5 Primers,6 Primers,7 Primers,8 Primers,9 Primers,10 Primer in NEW DELHI, DELHI

Posted

28 Oct 2025, 01:23 pm

Deadline

18 Nov 2025, 02:00 pm

EMD

₹20,000

Value

₹20,00,000

Progress

Issue28 Oct 2025, 01:23 pm
AwardPending
Explore all 4 tabs to view complete tender details

Quantity

64

Category

1 Primers

Bid Type

Two Packet Bid

Categories 4

Central Health Service Ministry Of Health And Family Welfare announces a tender for 1 Primers, 2 Primers, 3 Primers, 4 Primers, 5 Primers, 6 Primers, 7 Primers, 8 Primers, 9 Primers, 10 Primers, 11 Primers, 12 Primers, 13 Primers, 14 Primers, a Restriction Enzymes, b Restriction Enzymes, c Restriction Enzymes, d Restriction Enzymes, DNA Extraction Kit, Dream Taq green PCR Master Mix, 100bp DNA ladder, 50bp DNA ladder in NEW DELHI, DELHI. Quantity: 64. Submission Deadline: 18-11-2025 14: 00: 00. Last date to apply is approaching fast!

Bill of Quantities (BOQ) 22 Items

Item # Title Description Quantity Unit Consignee Delivery (Days)
1 1 Primers Forward CCCCTAGATGGGGGAACAGA 20bp 1 nos storeslabchem.vmmc 30
2 2 Primers REVERSE GCATTGTTCTCGGGTGCAAG 20bp 1 nos storeslabchem.vmmc 30
3 3 Primers Forward AGGCAGATGGACCTGGATTTGA 22bp 1 nos storeslabchem.vmmc 30
4 4 Primers REVERSE TGGCTTGCAAATAGACTCATCTCC 24bp 1 nos storeslabchem.vmmc 30
5 5 Primers FORWARD GCCTGGCACATAGTAGGCCC 1 nos storeslabchem.vmmc 30
6 6 Primers REVERSE CTTCCTAGCCAGCCGGCATC 1 nos storeslabchem.vmmc 30
7 7 Primers FORWARD CTCCTGGAAGCTGATCTTAGG 21bp 1 nos storeslabchem.vmmc 30
8 8 Primers REVERSE CCTCTCTCTATCTAGCTCCAGCC 21bp 1 nos storeslabchem.vmmc 30
9 9 Primers Forward control GCCAAACACTTCGAGCAC 18bp 1 nos storeslabchem.vmmc 30
10 10 Primers Reverse control CGGCTCCTGGATGGCCTCA 18bp 1 nos storeslabchem.vmmc 30
11 11 Primers Forward specific CAGAGCATGGACAGGGAGCAAG 22bp 1 nos storeslabchem.vmmc 30
12 12 Primers Reverse specific TGCAGGACGCCGCGCTGATC 20bp 1 nos storeslabchem.vmmc 30
13 13 Primers Forward ACAAGGGGCGTTAGCTTCAT 20bp 1 nos storeslabchem.vmmc 30
14 14 Primers Reverse GGTATCACCGGTCAGCAGTC 20bp 1 nos storeslabchem.vmmc 30
15 a Restriction Enzymes Restriction Enzymes catalog R0585L Blp 1 2500units 2 nos storeslabchem.vmmc 30
16 b Restriction Enzymes Restriction Enzymes catalog R0149S Fast digest Taq 1 4000 Units 2 nos storeslabchem.vmmc 30
17 c Restriction Enzymes Restriction enzyme catalog R3505L Eag 1 High Fidelity 2500 Units 2 nos storeslabchem.vmmc 30
18 d Restriction Enzymes Restricted Enzymes catalog R3505L Drd 1 1500 units 2 nos storeslabchem.vmmc 30
19 DNA Extraction Kit DNA Extraction Kit for Human blood samples spin column based 250 PREP 10 kits storeslabchem.vmmc 30
20 Dream Taq green PCR Master Mix Dream Taq green PCR Master Mix 2x 100 RXN 20 kits storeslabchem.vmmc 30
21 100bp DNA ladder DNA Ladder 100bp 1x50ug with loading dye ready to use 6 nos storeslabchem.vmmc 30
22 50bp DNA ladder DNA Ladder 50bp 1x50ug with loading dye ready to use 6 nos storeslabchem.vmmc 30

AI-Powered Bidder Prediction

Companies most likely to bid

Unlock Bidder Insights

AI predictions on likely bidders

Required Documents

1

Experience Criteria

2

Past Performance

3

Bidder Turnover

4

Certificate (Requested in ATC)

5

OEM Authorization Certificate

6

OEM Annual Turnover *In case any bidder is seeking exemption from Experience / Turnover Criteria

7

the supporting documents to prove his eligibility for exemption must be uploaded for evaluation by the buyer

Similar Tenders

Trizol RNA iso plus,LA Taq Polymerase,Primescript 1 strand cDNA Synthesis Kit,Item 1,Item 2

Department of Agricultural Research and Education (DARE)

BANGALORE, KARNATAKA

View Details

SPINeasy RNA kit for Feces 50 preps,PrimeScript One Step RT PCR Kit Ver 2 Dye Plus,Item 1,Item 2,It

Department of Agricultural Research and Education (DARE)

BANGALORE, KARNATAKA

View Details