Central Health Service Ministry Of Health And Family Welfare announces a tender for 1 Primers, 2 Primers, 3 Primers, 4 Primers, 5 Primers, 6 Primers, 7 Primers, 8 Primers, 9 Primers, 10 Primers, 11 Primers, 12 Primers, 13 Primers, 14 Primers, a Restriction Enzymes, b Restriction Enzymes, c Restriction Enzymes, d Restriction Enzymes, DNA Extraction Kit, Dream Taq green PCR Master Mix, 100bp DNA ladder, 50bp DNA ladder in NEW DELHI, DELHI. Quantity: 64. Submission Deadline: 18-11-2025 14: 00: 00. Last date to apply is approaching fast!
Tender Notice for 1 Primers,2 Primers,3 Primers,4 Primers,5 Primers,6 Primers,7 Primers,8 Primers,9 Primers,10 Primer in NEW DELHI, DELHI
Progress
Quantity
64
Category
1 Primers
Bid Type
Two Packet Bid
Categories
4
Bill of Quantities (BOQ)
22 Items
| Item # | Title | Description | Quantity | Unit | Consignee | Delivery (Days) |
|---|---|---|---|---|---|---|
| 1 | 1 Primers | Forward CCCCTAGATGGGGGAACAGA 20bp | 1 | nos | storeslabchem.vmmc | 30 |
| 2 | 2 Primers | REVERSE GCATTGTTCTCGGGTGCAAG 20bp | 1 | nos | storeslabchem.vmmc | 30 |
| 3 | 3 Primers | Forward AGGCAGATGGACCTGGATTTGA 22bp | 1 | nos | storeslabchem.vmmc | 30 |
| 4 | 4 Primers | REVERSE TGGCTTGCAAATAGACTCATCTCC 24bp | 1 | nos | storeslabchem.vmmc | 30 |
| 5 | 5 Primers | FORWARD GCCTGGCACATAGTAGGCCC | 1 | nos | storeslabchem.vmmc | 30 |
| 6 | 6 Primers | REVERSE CTTCCTAGCCAGCCGGCATC | 1 | nos | storeslabchem.vmmc | 30 |
| 7 | 7 Primers | FORWARD CTCCTGGAAGCTGATCTTAGG 21bp | 1 | nos | storeslabchem.vmmc | 30 |
| 8 | 8 Primers | REVERSE CCTCTCTCTATCTAGCTCCAGCC 21bp | 1 | nos | storeslabchem.vmmc | 30 |
| 9 | 9 Primers | Forward control GCCAAACACTTCGAGCAC 18bp | 1 | nos | storeslabchem.vmmc | 30 |
| 10 | 10 Primers | Reverse control CGGCTCCTGGATGGCCTCA 18bp | 1 | nos | storeslabchem.vmmc | 30 |
| 11 | 11 Primers | Forward specific CAGAGCATGGACAGGGAGCAAG 22bp | 1 | nos | storeslabchem.vmmc | 30 |
| 12 | 12 Primers | Reverse specific TGCAGGACGCCGCGCTGATC 20bp | 1 | nos | storeslabchem.vmmc | 30 |
| 13 | 13 Primers | Forward ACAAGGGGCGTTAGCTTCAT 20bp | 1 | nos | storeslabchem.vmmc | 30 |
| 14 | 14 Primers | Reverse GGTATCACCGGTCAGCAGTC 20bp | 1 | nos | storeslabchem.vmmc | 30 |
| 15 | a Restriction Enzymes | Restriction Enzymes catalog R0585L Blp 1 2500units | 2 | nos | storeslabchem.vmmc | 30 |
| 16 | b Restriction Enzymes | Restriction Enzymes catalog R0149S Fast digest Taq 1 4000 Units | 2 | nos | storeslabchem.vmmc | 30 |
| 17 | c Restriction Enzymes | Restriction enzyme catalog R3505L Eag 1 High Fidelity 2500 Units | 2 | nos | storeslabchem.vmmc | 30 |
| 18 | d Restriction Enzymes | Restricted Enzymes catalog R3505L Drd 1 1500 units | 2 | nos | storeslabchem.vmmc | 30 |
| 19 | DNA Extraction Kit | DNA Extraction Kit for Human blood samples spin column based 250 PREP | 10 | kits | storeslabchem.vmmc | 30 |
| 20 | Dream Taq green PCR Master Mix | Dream Taq green PCR Master Mix 2x 100 RXN | 20 | kits | storeslabchem.vmmc | 30 |
| 21 | 100bp DNA ladder | DNA Ladder 100bp 1x50ug with loading dye ready to use | 6 | nos | storeslabchem.vmmc | 30 |
| 22 | 50bp DNA ladder | DNA Ladder 50bp 1x50ug with loading dye ready to use | 6 | nos | storeslabchem.vmmc | 30 |
AI-Powered Bidder Prediction
Companies most likely to bid
Unlock Bidder Insights
AI predictions on likely bidders
Required Documents
Experience Criteria
Past Performance
Bidder Turnover
Certificate (Requested in ATC)
OEM Authorization Certificate
OEM Annual Turnover *In case any bidder is seeking exemption from Experience / Turnover Criteria
the supporting documents to prove his eligibility for exemption must be uploaded for evaluation by the buyer
Similar Tenders
Trizol RNA iso plus,LA Taq Polymerase,Primescript 1 strand cDNA Synthesis Kit,Item 1,Item 2
Department of Agricultural Research and Education (DARE)
BANGALORE, KARNATAKA
SPINeasy RNA kit for Feces 50 preps,PrimeScript One Step RT PCR Kit Ver 2 Dye Plus,Item 1,Item 2,It
Department of Agricultural Research and Education (DARE)
BANGALORE, KARNATAKA
Download FREE!
Access all tender documents at no cost
Documents 6
GeM-Bidding-8518660.pdf
Main Document
BOQ Document
BOQ
BOQ Document
BOQ
Other Documents
OTHER
Buyer uploaded ATC document
ATC
GEM General Terms and Conditions Document
GEM_GENERAL_TERMS_AND_CONDITIONS
GeM-Bidding-8518660.pdf
Main Document
BOQ Document
BOQ
BOQ Document
BOQ
Other Documents
OTHER
Buyer uploaded ATC document
ATC
GEM General Terms and Conditions Document
GEM_GENERAL_TERMS_AND_CONDITIONS