TenderDekho Logo
Acetic Acid state-wide in Himachal Pradesh

Acetic Acid Tenders in Himachal Pradesh

Explore state-wide acetic acid procurement opportunities in Himachal Pradesh. Major buyers include Central University Of Himachal Pradesh and Indian Army. Tender values range from ₹1.3 Lakh to ₹19.8 Lakh. EMD up to ₹21K. Procurement sources: Gem (11). Track active bids, eligibility criteria, and deadlines for this state.

Live Opportunities
National Reach
0

Potassium hydroxide 1000 g,4 percent Paraformaldehyde 500 ml,Phenol chloroform isoamyl alcohol 300

Central University Of Himachal Pradesh

KANGRA, HIMACHAL PRADESHPosted 26 Mar
GEMGoods3 Documents
Category: Potassium hydroxide 1000 g , 4 percent Paraformaldehyde 500 ml , Phenol chloroform isoamyl alcohol 300 ml , Sodium carbonate 500 g , Thiobarbituric acid 125 g , Sodium hydroxide 1000 g , Superoxide Dismutase antioxidant assay kit calorimetric 1 , Riboflavin 100 g , Trypan Blue zero point four percent Solution 50 ml , Guaiacol 250 g , Iron chloride FeCl3 100 g , Potassium Ferricyanide 100 g , Iodine 100 g , Dichloromethane 100 ml , Iron sulfate FeSO4 500 g , Sodium Hypochlorite NaOCl 500 ml , Perchloric Acid HClO4 500 ml , Zinc Chloride ZnCl2 500 g , Sodium Iodide NaI 500 g , Phosphate Buffer 500 ml , DNA Extraction Kit for Animal tissue 2 , PCR kit 2 , PBS Phosphate buffered saline 1000 ml , Sodium Chloride 1000 g , Bouins fixative 500 ml , Bradford reagent 1000 ml , ALT Activity kit Calorimetric 50 rxn , AST Activity kit Calorimetric 50 rxn , ALP Activity kit Calorimetric 50 rxn , Giemsa stain 50 ml , Ethanol 15 L , Nitroblue tetrazolium NBT 25 g , S Acetylthiocholine iodide 25 g , Potassium cyanide 500 g , Drabkins reagent 500 ml , Hayemis RBC diluting fluid 100 ml , Turks WBC diluting fluid 100 ml , Heparin anticoagulant 50 ml , Hydrogen peroxide 1500 ml , 1 Chloro2 4 Dinitrobenzene CDNB AR 100 g , Glutathione Reduced GSH 25 g , Two point five percent Glutaraldehyde 500 ml , Diethyl ether AR 1000 ml , Petroleum ether AR grade 2500 ml , Pyrogallol 100 g , Nitric acid 1000 ml , Perchloric acid 1000 ml , Glacial acetic acid 1500 ml , L tryptophan extrapure 100 mg , Barium chloride dehydrate 500 g , Gum acacia 500 g , Magnesium chloride hexahydrate 500 g , Potassium nitrate 500 g , Methyl cellosolve 1000 ml , Citric acid 500 g , Sodium citrate tribasic dehydrate extrapure 98 percent 500 g , Anthrone ACS 98 percent 25 g , N propanol 1000 ml , Ammonium metavanadate 100 g , Phenol crystalline extrapure AR 500 g , Boric acid 500 g , Papain 100 g , Ferric chloride hexahydrate A 100 g , Starch 1000 g , Donepezil hydrochloride 1 , Master mix PCR 100 rxn , DPPH 2 g , ATBS 5 g , CTAB 3 kit , Mcnkey broth 500 g , MHA muller hinton broth 500 g , Sterile disc 2 pack , Plate count agar 500 g , M17 agar 500 g , M17 broth 500 g , Ox bile Ox gall 500 g , MHA agar 500 g , MRS broth 1000 g , MRS agar 1000 g , Pepsin and cysteine 25 g each , X gal 5 bromo 4 chloro 3 indolyl beta D galactopyranoside 1 g , 10 micro leter IPTG iso propylthio beta D galactopyranoside 5 g , Columbia agar 500 g , DNA extraction kit for bacteria 1 pack , Molecular primer 27F 5AGAGTTTGATCCTGGCTCAG 3 and 1492R 5 TACGGTACCTTGTTACGACTT3 , Wurster reagent N N N N tetramethyl pphenylenediamine 10 g , Sucrose lactose maltose glucose fructose xylose sorbitol 500 g each , D Arabinose 100 g , D Reffinose 100 g , Gram staining kit 200 ml reagents , Trypsin 10 g , Nutrient Agar 500 g , Nutrient Broth 500 g
Deadline
16 Apr 2025
View Details

RPMI1640 Medium. HEPES Modifcation with L glutamine and 25mM HEPES without sodium bicarbonate powde

Central University Of Himachal Pradesh

KANGRA, HIMACHAL PRADESHPosted 9 Apr
GEMGoods3 Documents
Category: RPMI1640 Medium. HEPES Modifcation with L glutamine and 25mM HEPES without sodium bicarbonate powder suitable for cell culture , Fetal Bovine Serum non-USA origin sterile fltered suitable for cell culture , Ethanol absolute. for analysis EMPARTA ACS , Trypsin from porcine pancreas lyophilized powder BioReagent , Thiazolyl Blue Tetrazolium Bromide powder BioReagent suitable for cell culture suitable for insect cell culture , Trypan Blue solution , Corning syringe flters , LB Broth with agar , LB Broth Miller Highly- referenced nutrient-rich microbial growth powder medium suitable for regular E coli culture , Ethylene glycol analytical standard , Ethylenediaminetetraacetic acid ACS reagent , Zinc acetate , Polyvinylpyrrolidone mol wt number average molecular weight , Gadolinium III nitrate hexahydrate , Chromium III nitrate nonahydrate , Cadmium chloride , N N Dimethylformamide ACS reagent , I Sodium citrate anhydrous EMPROVE ESSENTIAL , Ascorbic acid , Hydrogen peroxide solution , Hydrazine hydrate solution , Tetra-n- butyl orthotitanate , Ferric nitrate nonahydrate , Magnesium nitrate hexahydrate , Samarium III nitrate hexahydrate , acetic acid , Poly vinyl alcohol pva , Samarium III oxide , Niobium V oxide , Molybdenum IV oxide , Samarium powder for synthesis , Cobalt II chloride anhydrous , Nickel II chloride , Lithium chloride , Hydrofluoric acid , Silver nitrate solution , Ammonium hydroxide solution , Silicon nanoparticles
Deadline
10 May 2025
View Details

Refine Your Search

Quick filters based on popular searches

Popular
Top States
Top Cities
Top Organizations
Sources

Click any filter to narrow down your results • Applied filters shown with opacity

4 Phenyl 1 2 4 triazoline 3 5 dione 5G,LCMS grade Water,Acetonitrile UHP LCMS grade,Formic acid LCM

Indian Council Of Agricultural Research (icar)

SHIMLA, HIMACHAL PRADESHPosted 28 Jul
EMD: ₹20,800
GEMGoods3 Documents
Category: 4 Phenyl 1 2 4 triazoline 3 5 dione 5G , LCMS grade Water , Acetonitrile UHP LCMS grade , Formic acid LCMS grade 50 ML , Ammonium acetate LCMS grade 25G , Trifluoroacetic Acid LCMS Grade 10 ML , 2 Propanol HPLC , Hexane HPLC , Acetic Acid HPLC Grade 250 ML , Ammonium format LCMS Grade 100G , Sodium formate LCMS Grade 100 ML , Vacuubrand rotary vane pump oil B1L , Aspergillus oryzae 10G , Streptomyces griseus 5G , Carboxypeptidase G from Pseudomonas sp
Deadline
18 Aug 2025
View Details

Acetic Acid,Acetone,Acetonitrile,Activated Carbon powder,Ammonium Chloride,Ammonium Hydroxide,Ammon

Himachal Pradesh State Civil Supplies Corporation Limited (hpscsc)

SHIMLA, HIMACHAL PRADESHPosted 4 Aug
GEMGoods4 Documents
Category: Acetic Acid , Acetone , Acetonitrile , Activated Carbon powder , Ammonium Chloride , Ammonium Hydroxide , Ammonium molybedate , Anhudrous monobasic Sodium phosphate , Anhydrous calcium chloride , Anhydrous Sodium Sulphate , Antimony trichloride , Barium Chloride , Barium hydroxide , Benzoic acid , Bromophenol blue indicator , Butanol , Butylated Hydroxytolune , Calcium carbonate , Calcium Chloride , Carbon tetrachloride , Chloroacetic acid , Chloroform , Chromic acid , Copper sulphate pentahydrate , Diethyl ether , Dimethly glyoxime solution , Disidium Hydrogen phosphate , Disodium ethylene diamine tetra acetate dihydrate , Distilled Water , Eriochrome Black T Indicator , Ethanol Pure , Ferric chloride , Ferrous sulphate , Ferrrous ammonium sulphate , Filter paper , Formic acid , Furfural solution , Glacial acetic acid , HPLC Grade water , Hydrochloric acid , Mask , Methanol , Methylene blue Indicator , Murexide , Nitric acid , Orthophosphoric Acid , p-dimethyl amino benzaldehyde , Petroleum ether , Phenolphathelein , Phloroglusinol , Phosphorus pentoxide , Picric acid , Poatassium Iiodate , Potassium aluminium sulphate , Potassium chromate , Potassium Dichromate , Potassium hydroxide , Potassium iodide , Potassium permagnate , Potassium persulphate , Potassium sodium tartrate , Potassium thiocyanate , Salicylic acid , Silver nitrate , Small pumice pieces , Sodium carbonate , Sodium Chloride extra pure , Sodium hydroxide , Sodium thiosulphate pentahydrate , Starch , Sulphuric acid , Surgical gloves , Tartaric acid , Thioglycollic acid , Tissue roll , Trifluoracetic acid , Whatman Filter Paper , Wijs Iodine monochloride , Zinc acetate
Deadline
19 Aug 2025
View Details

one three Dinitrobenzene,2 2 azino bis 3 Ethylbenzothiazoline 6 sulphonic acid ABTS,2 Propanol,3 5

Central University Of Himachal Pradesh

KANGRA, HIMACHAL PRADESHPosted 19 Nov
₹5.0 L
GEMGoods3 Documents
Category: one three Dinitrobenzene , 2 2 azino bis 3 Ethylbenzothiazoline 6 sulphonic acid ABTS , 2 Propanol , 3 5 Dimethoxy 4 hydroxyacetophenone Acetosyringone , Acetone , Acetic Acid Glacial , Acetonitrile , Acrylamide , Activated Charcoal powder , Aluminium potassium sulphate dodecahydrate Potash Alum , Ammonia Solution Ammonium Hydroxide , Ammonium chloride , Ancymidol , Andrographolide , Bismuth III subnitrate , Bromine Water , Bromocresol Green , Bromocresol purple , Carboxymethyl cellulose sodium salt , Chitin , Chitosan , Chloroform , Citric Acid monohydrate , Curzerenone , Dextrose D plus Glucose anhydrous , Diethylene glycol , DMSO , DPPH 2 2 Diphenyl 1 picrylhydrazyl , Dragendorff s Reagent , Ethanol , Ethyl Acetate , Ethylene Glycol , Ferrous chloride tetra hydrate , Formaldehyde , Glycerol , Hydrochloric Acid , Hydrogen Peroxide , Hyperoside , Jasmonic Acid , lactic acid , L Ascorbic acid , Litmus solution blue , Litmus solution Red , Luria Bertani Agar Miller Miller Luria Bertani Agar , Luria Bertani Broth Miller Miller Luria Bertani Broth , Mercuric Chloride , Methanol , Methyl orange , Methyl red , Millons Reagent , Molisch Reagent , Mueller Hinton Agar , Mueller Hinton Broth , Murashige and Skoog media wCaCl2 and vitamins and sucrose wo agar , Murashige and Skoog Medium w CaCl2 and Vitamins wo Sucrose and Agar , Murashige and Skoog Microelements solution 100X , Murashige and Skoog Vitamins 1000x , Murashige and SkoogMacroelements Solution 10X , n butanol , Neoandrographolide , n Hexane , Ninhydrin , Nitric Acid , n propanol , Paclobutrazol , Perchloric Acid , Petroleum Ether , Phenol Crystal , Phenolphthalein , Potassium dichromate , Potassium Iodide , Potassium permanganate , Quercetin , Rottlerin , Silica Gel G for TLC , Silver Nitrate , Sodium bicarbonate , Sodium bisulphite , Sodium Carbonate anhydrous , Sodium chloride , Sodium Hydroxide , Sodium lactate , sodium nitroprusside solution , Sucrose , Sulphuric Acid , Tartaric acid , Toluene , Tween 80 , Universal Indicator solution , Wagner reagent , Xylene , Agarose , Ammonium Acetate , Ammonium persulphate , Isoamyl Alcohol , Boric Acid , Bromophenol Blue , Coomassie Briliant Blue , CTAB N Cetyl N N N trimethylammonium bromide buffer , DNA Polymerase with standard Taq Buffer with MG2 plus , dNTPs , Ethidium Bromide , Polyvinylpyrrolidone , TEMED , Tris HCl , Xylene cyanol , Urea , Acryl 29 ratio 1 3dot 3 cross linker , 10X TBE solution , Phenol , MgCl2 , DNA Ladder , Protein markers , Primers forward n reverse , Plant Genomic DNA isolation Teaching Kits , RNA extraction Teaching Kits , PCR Teaching Kits , Diphenyl amine reagent , Saline citrate buffer pH 7 , DEPEC water , RNA Ladder , DNA Amplification Universal Primers , Diluent for DNA Extraction
Deadline
10 Dec 2025
View Details