TenderDekho Logo
Acetic Acid state-wide in Himachal Pradesh

Acetic Acid Tenders in Himachal Pradesh

Explore state-wide acetic acid procurement opportunities in Himachal Pradesh. Track active bids, eligibility criteria, and deadlines for this state.

Location
Authority
0

Azomethine H monosodium salt hydrate,Calcium Chloride Dihydrate AR,Barium Chloride Dihydrate AR ACS

Indian Council Of Forestry Research And Education (icfre)

SHIMLA, HIMACHAL PRADESHPosted 17 Feb
₹1.4 L
GEMGoods3 Documents
Category: Azomethine H monosodium salt hydrate , Calcium Chloride Dihydrate AR , Barium Chloride Dihydrate AR ACS , Ammonium Ferrous Sulphate hexahydrate AR , Ortho phosphoric acid , Sulphuric acid , L Ascorbic acid , Acetone AR ACS , Potassium permanganate AR ACS , Diethylene triamine penta acetic acid AR , Sodium hydroxide pellets AR , Hydrochloride acid Conc , Ammonium fluoride , Ammonium acetate Cryst AR ACS , Acacia Gum Acacia, Gum Arabica , Copper AAS Std Soln Contains 1000 mg lit , Funnel Filtering 65mm , Conical Flasks 250ml Borosil , Conical Flasks 500ml Borosil , Measuring Cylinder Polypropylene 250ml , Measuring Cylinder Polypropylene 500ml , Pipettes, Measuring, Graduated Serological, Class A with calibration certificate 0.5ml , Pipettes, Measuring, Graduated Serological, Class A with calibration certificate 1ml , Pipettes, Measuring, Graduated Serological, Class A with calibration certificate 2ml , Pipettes, Measuring, Graduated Serological, Class A with calibration certificate 5ml , Pipettes, Measuring, Graduated Serological, Class A with calibration certificate 10ml , Conical Flask Polypropylene 250ml , Reagent Bottle Clear wide mouth with Polypropylene Blue screw cap 1000ml , Reagent Bottle Clear wide mouth with Polypropylene Blue screw cap 2000ml , Dropper, with rubber teat 15 cm , Stirring Rod, glass 6 x 200mm , Whattman Filter Paper No 1 125mm Pack of 100 , Tissue Paper Roll 50mtr , Blotting Sheets 46X57mm , Nitrile Gloves Medium , Rubber Hand Gloves Chemical and acid resistant Pair , Cedepol Lab Wash teepol , Pipette Pump Acrylonitrile Butadiene Styrene ABS 2ml , Pipette Pump Acrylonitrile Butadiene Styrene ABS 10ml , Pipette Pump Acrylonitrile Butadiene Styrene ABS 25ml , Hand wash , Disposable Face Mask , Cotton Roll , Foil Aluminum , Lab Coat Medium
Deadline
10 Mar 2025
View Details

4 Aminophenol 250gm,4 Bromo Aniline 25gm,Acetic acid Glacial 2500 ml,Acetone 2500 ml,Ammonia Soluti

Central University Of Himachal Pradesh

KANGRA, HIMACHAL PRADESHPosted 21 Feb
₹5.0 L
GEMGoods3 Documents
Category: 4 Aminophenol 250gm , 4 Bromo Aniline 25gm , Acetic acid Glacial 2500 ml , Acetone 2500 ml , Ammonia Solution Extra Pure 500 ml , Amoxicillin 1 gm , Ascorbic acid 25g , Benzaldehyde for Synthesis 500 mL , Cerium Nitrate hexahydrate 100g , Chloroform 2500 ml , Cobalt Chloride Hexahydrate 100gm , Copper Chloride anhydrous 250 gm , Copper Chloride dihydrate 500 gm , Diethyl ether 2500 ml , Dimethyl Sulphoxide 500ml , Ethanol 500ml , Ethyl Acetate 2500 ml , Hexadecyltrimethylammonium bromide 25g , Hexane 2500 ml , Hydrazine Hydrate 500ml , Hydroxy propyl Cellulose 5g , Iron II Sulphate 250g , Iso Propanol 2500 ml , Levofloxacin 1 gm , Lithium Aluminium Hydride for Synthesis 97 Percent 100 gm , L Phenylalanine 25g , Methanol 2500 ml , Methylene Chloride 2500ml , Millons Reagent 125 ml , Morpholine 500ml , N N Dimethyl Formamide 500 ml , N N methylenebisacrylamide 25g , Nitro Benzene 500ml , Para Toluene Sulphonic Acid 100gm , Paraffin Liquid Light 500ml , Polyvinylpyrrolidone 100g , Pyridine 500ml , Pyrrol 2 carboxaldehyde 5g , Rodamine B 25gm , Salicylaldehyde 100g , Schiffs Reagent 500 ml , Selenous acid 50g , Silica Gel G 500gm , Sodium Chloride 500gm , Sodium Dodecyl Sulfate 500g , Sodium Metal Pieces in Kerosene or Liquid Paraffin 500 gm , Sodium selenite 100g , Strontium Nitrate 500 gm , Succinic Acid 100gm , Sulphuric Acid 5000ml , Tempo 25 gm , Tetracycline 5 gm , Thioacetamide 100 gm , Thiophene for Synthesis 100 mL , Tollens Reagent 100 ml , Toulene 2500 ml , Tryptophan 25 gm , Yattrium III nitrate hexahydrate 25 gm , Zinc Chloride 500 gm , Zinc Dust 500 gm , Zirconium Oxychloride 500 gm
Deadline
14 Mar 2025
View Details

RPMI1640 Medium. HEPES Modifcation with L glutamine and 25mM HEPES without sodium bicarbonate powde

Central University Of Himachal Pradesh

KANGRA, HIMACHAL PRADESHPosted 21 Feb
GEMGoods3 Documents
Category: RPMI1640 Medium. HEPES Modifcation with L glutamine and 25mM HEPES without sodium bicarbonate powder suitable for cell culture , Fetal Bovine Serum non-USA origin sterile fltered suitable for cell culture , Ethanol absolute for analysis EMPARTA ACS , Trypsin from porcine pancreas lyophilized powder BioReagent , Thiazolyl Blue Tetrazolium Bromide powder BioReagent suitable for cell culture suitable for insect cell culture , Trypan Blue solution , Corning syringe flters cellulose acetate membrane surfactant-free diam. 28 mm pore size 0.2 , LB Broth with agar , LB Broth Miller Highly-referenced nutrient-rich microbial growth powder medium suitable for regular E coli culture , Ethylene glycol analytical standard , Ethylenediaminetetraacetic acid ACS reagent , Zinc acetate , Polyvinylpyrrolidone mol wt number average molecular weight Mn 360kDa , Gadolinium III nitrate hexahydrate , Chromium III nitrate nonahydrate 99 , Cadmium chloride , N N Dimethylformamide , I Sodium citrate. anhydrous EMPROVE ESSENTIAL USP FCC E 331 , Ascorbic acid , Hydrogen peroxide solution , Hydrazine hydrate solution , Tetra-n-butyl orthotitanate , Ferric nitrate nonahydrate , Magnesium nitrate hexahydrate , Samarium III nitrate hexahydrate , acetic acid , Poly vinyl alcohol pva , Samarium III oxide , Niobium V oxide , Molybdenum IV oxide , Samarium powder for synthesis , Cobalt II chloride anhydrous , Nickel II chloride , Lithium chloride , Hydrofluoric acid , Silver nitrate solution , Ammonium hydroxide solution , Silicon nanoparticles 40 nm avg
Deadline
14 Mar 2025
View Details

Potassium hydroxide 1000 g,4 percent Paraformaldehyde 500 ml,Phenol chloroform isoamyl alcohol 300

Central University Of Himachal Pradesh

KANGRA, HIMACHAL PRADESHPosted 26 Mar
GEMGoods3 Documents
Category: Potassium hydroxide 1000 g , 4 percent Paraformaldehyde 500 ml , Phenol chloroform isoamyl alcohol 300 ml , Sodium carbonate 500 g , Thiobarbituric acid 125 g , Sodium hydroxide 1000 g , Superoxide Dismutase antioxidant assay kit calorimetric 1 , Riboflavin 100 g , Trypan Blue zero point four percent Solution 50 ml , Guaiacol 250 g , Iron chloride FeCl3 100 g , Potassium Ferricyanide 100 g , Iodine 100 g , Dichloromethane 100 ml , Iron sulfate FeSO4 500 g , Sodium Hypochlorite NaOCl 500 ml , Perchloric Acid HClO4 500 ml , Zinc Chloride ZnCl2 500 g , Sodium Iodide NaI 500 g , Phosphate Buffer 500 ml , DNA Extraction Kit for Animal tissue 2 , PCR kit 2 , PBS Phosphate buffered saline 1000 ml , Sodium Chloride 1000 g , Bouins fixative 500 ml , Bradford reagent 1000 ml , ALT Activity kit Calorimetric 50 rxn , AST Activity kit Calorimetric 50 rxn , ALP Activity kit Calorimetric 50 rxn , Giemsa stain 50 ml , Ethanol 15 L , Nitroblue tetrazolium NBT 25 g , S Acetylthiocholine iodide 25 g , Potassium cyanide 500 g , Drabkins reagent 500 ml , Hayemis RBC diluting fluid 100 ml , Turks WBC diluting fluid 100 ml , Heparin anticoagulant 50 ml , Hydrogen peroxide 1500 ml , 1 Chloro2 4 Dinitrobenzene CDNB AR 100 g , Glutathione Reduced GSH 25 g , Two point five percent Glutaraldehyde 500 ml , Diethyl ether AR 1000 ml , Petroleum ether AR grade 2500 ml , Pyrogallol 100 g , Nitric acid 1000 ml , Perchloric acid 1000 ml , Glacial acetic acid 1500 ml , L tryptophan extrapure 100 mg , Barium chloride dehydrate 500 g , Gum acacia 500 g , Magnesium chloride hexahydrate 500 g , Potassium nitrate 500 g , Methyl cellosolve 1000 ml , Citric acid 500 g , Sodium citrate tribasic dehydrate extrapure 98 percent 500 g , Anthrone ACS 98 percent 25 g , N propanol 1000 ml , Ammonium metavanadate 100 g , Phenol crystalline extrapure AR 500 g , Boric acid 500 g , Papain 100 g , Ferric chloride hexahydrate A 100 g , Starch 1000 g , Donepezil hydrochloride 1 , Master mix PCR 100 rxn , DPPH 2 g , ATBS 5 g , CTAB 3 kit , Mcnkey broth 500 g , MHA muller hinton broth 500 g , Sterile disc 2 pack , Plate count agar 500 g , M17 agar 500 g , M17 broth 500 g , Ox bile Ox gall 500 g , MHA agar 500 g , MRS broth 1000 g , MRS agar 1000 g , Pepsin and cysteine 25 g each , X gal 5 bromo 4 chloro 3 indolyl beta D galactopyranoside 1 g , 10 micro leter IPTG iso propylthio beta D galactopyranoside 5 g , Columbia agar 500 g , DNA extraction kit for bacteria 1 pack , Molecular primer 27F 5AGAGTTTGATCCTGGCTCAG 3 and 1492R 5 TACGGTACCTTGTTACGACTT3 , Wurster reagent N N N N tetramethyl pphenylenediamine 10 g , Sucrose lactose maltose glucose fructose xylose sorbitol 500 g each , D Arabinose 100 g , D Reffinose 100 g , Gram staining kit 200 ml reagents , Trypsin 10 g , Nutrient Agar 500 g , Nutrient Broth 500 g
Deadline
16 Apr 2025
View Details

RPMI1640 Medium. HEPES Modifcation with L glutamine and 25mM HEPES without sodium bicarbonate powde

Central University Of Himachal Pradesh

KANGRA, HIMACHAL PRADESHPosted 9 Apr
GEMGoods3 Documents
Category: RPMI1640 Medium. HEPES Modifcation with L glutamine and 25mM HEPES without sodium bicarbonate powder suitable for cell culture , Fetal Bovine Serum non-USA origin sterile fltered suitable for cell culture , Ethanol absolute. for analysis EMPARTA ACS , Trypsin from porcine pancreas lyophilized powder BioReagent , Thiazolyl Blue Tetrazolium Bromide powder BioReagent suitable for cell culture suitable for insect cell culture , Trypan Blue solution , Corning syringe flters , LB Broth with agar , LB Broth Miller Highly- referenced nutrient-rich microbial growth powder medium suitable for regular E coli culture , Ethylene glycol analytical standard , Ethylenediaminetetraacetic acid ACS reagent , Zinc acetate , Polyvinylpyrrolidone mol wt number average molecular weight , Gadolinium III nitrate hexahydrate , Chromium III nitrate nonahydrate , Cadmium chloride , N N Dimethylformamide ACS reagent , I Sodium citrate anhydrous EMPROVE ESSENTIAL , Ascorbic acid , Hydrogen peroxide solution , Hydrazine hydrate solution , Tetra-n- butyl orthotitanate , Ferric nitrate nonahydrate , Magnesium nitrate hexahydrate , Samarium III nitrate hexahydrate , acetic acid , Poly vinyl alcohol pva , Samarium III oxide , Niobium V oxide , Molybdenum IV oxide , Samarium powder for synthesis , Cobalt II chloride anhydrous , Nickel II chloride , Lithium chloride , Hydrofluoric acid , Silver nitrate solution , Ammonium hydroxide solution , Silicon nanoparticles
Deadline
10 May 2025
View Details

4 Phenyl 1 2 4 triazoline 3 5 dione 5G,LCMS grade Water,Acetonitrile UHP LCMS grade,Formic acid LCM

Indian Council Of Agricultural Research (icar)

SHIMLA, HIMACHAL PRADESHPosted 28 Jul
EMD: ₹20,800
GEMGoods3 Documents
Category: 4 Phenyl 1 2 4 triazoline 3 5 dione 5G , LCMS grade Water , Acetonitrile UHP LCMS grade , Formic acid LCMS grade 50 ML , Ammonium acetate LCMS grade 25G , Trifluoroacetic Acid LCMS Grade 10 ML , 2 Propanol HPLC , Hexane HPLC , Acetic Acid HPLC Grade 250 ML , Ammonium format LCMS Grade 100G , Sodium formate LCMS Grade 100 ML , Vacuubrand rotary vane pump oil B1L , Aspergillus oryzae 10G , Streptomyces griseus 5G , Carboxypeptidase G from Pseudomonas sp
Deadline
18 Aug 2025
View Details

Acetic Acid,Acetone,Acetonitrile,Activated Carbon powder,Ammonium Chloride,Ammonium Hydroxide,Ammon

Himachal Pradesh State Civil Supplies Corporation Limited (hpscsc)

SHIMLA, HIMACHAL PRADESHPosted 4 Aug
GEMGoods4 Documents
Category: Acetic Acid , Acetone , Acetonitrile , Activated Carbon powder , Ammonium Chloride , Ammonium Hydroxide , Ammonium molybedate , Anhudrous monobasic Sodium phosphate , Anhydrous calcium chloride , Anhydrous Sodium Sulphate , Antimony trichloride , Barium Chloride , Barium hydroxide , Benzoic acid , Bromophenol blue indicator , Butanol , Butylated Hydroxytolune , Calcium carbonate , Calcium Chloride , Carbon tetrachloride , Chloroacetic acid , Chloroform , Chromic acid , Copper sulphate pentahydrate , Diethyl ether , Dimethly glyoxime solution , Disidium Hydrogen phosphate , Disodium ethylene diamine tetra acetate dihydrate , Distilled Water , Eriochrome Black T Indicator , Ethanol Pure , Ferric chloride , Ferrous sulphate , Ferrrous ammonium sulphate , Filter paper , Formic acid , Furfural solution , Glacial acetic acid , HPLC Grade water , Hydrochloric acid , Mask , Methanol , Methylene blue Indicator , Murexide , Nitric acid , Orthophosphoric Acid , p-dimethyl amino benzaldehyde , Petroleum ether , Phenolphathelein , Phloroglusinol , Phosphorus pentoxide , Picric acid , Poatassium Iiodate , Potassium aluminium sulphate , Potassium chromate , Potassium Dichromate , Potassium hydroxide , Potassium iodide , Potassium permagnate , Potassium persulphate , Potassium sodium tartrate , Potassium thiocyanate , Salicylic acid , Silver nitrate , Small pumice pieces , Sodium carbonate , Sodium Chloride extra pure , Sodium hydroxide , Sodium thiosulphate pentahydrate , Starch , Sulphuric acid , Surgical gloves , Tartaric acid , Thioglycollic acid , Tissue roll , Trifluoracetic acid , Whatman Filter Paper , Wijs Iodine monochloride , Zinc acetate
Deadline
19 Aug 2025
View Details
Chat with us