Aliphatic Solvents state-wide in Himachal Pradesh

Aliphatic Solvents Tenders in Himachal Pradesh

Explore state-wide aliphatic solvents procurement opportunities in Himachal Pradesh. Major buyers include Central University Of Himachal Pradesh and Higher Education Department. Tender values up to ₹5.0 Lakh. EMD ranges from ₹Infinity Cr to ₹-InfinityK. Procurement sources: Gem (7). Track active bids, eligibility criteria, and deadlines for this state.

Live Opportunities

National Reach

0 tenders

Oxalic acid graterthan 99point5 percent CAS 6153-56-6,2 4 Dinitrophenol 99 percent CAS 51-28-5 3x10

Central University Of Himachal Pradesh

KANGRA, HIMACHAL PRADESHPosted 22 Mar

GEMGoods3 Documents

Potassium hydroxide 1000 g,4 percent Paraformaldehyde 500 ml,Phenol chloroform isoamyl alcohol 300

Central University Of Himachal Pradesh

KANGRA, HIMACHAL PRADESHPosted 26 Mar

GEMGoods3 Documents

Category: Potassium hydroxide 1000 g , 4 percent Paraformaldehyde 500 ml , Phenol chloroform isoamyl alcohol 300 ml , Sodium carbonate 500 g , Thiobarbituric acid 125 g , Sodium hydroxide 1000 g , Superoxide Dismutase antioxidant assay kit calorimetric 1 , Riboflavin 100 g , Trypan Blue zero point four percent Solution 50 ml , Guaiacol 250 g , Iron chloride FeCl3 100 g , Potassium Ferricyanide 100 g , Iodine 100 g , Dichloromethane 100 ml , Iron sulfate FeSO4 500 g , Sodium Hypochlorite NaOCl 500 ml , Perchloric Acid HClO4 500 ml , Zinc Chloride ZnCl2 500 g , Sodium Iodide NaI 500 g , Phosphate Buffer 500 ml , DNA Extraction Kit for Animal tissue 2 , PCR kit 2 , PBS Phosphate buffered saline 1000 ml , Sodium Chloride 1000 g , Bouins fixative 500 ml , Bradford reagent 1000 ml , ALT Activity kit Calorimetric 50 rxn , AST Activity kit Calorimetric 50 rxn , ALP Activity kit Calorimetric 50 rxn , Giemsa stain 50 ml , Ethanol 15 L , Nitroblue tetrazolium NBT 25 g , S Acetylthiocholine iodide 25 g , Potassium cyanide 500 g , Drabkins reagent 500 ml , Hayemis RBC diluting fluid 100 ml , Turks WBC diluting fluid 100 ml , Heparin anticoagulant 50 ml , Hydrogen peroxide 1500 ml , 1 Chloro2 4 Dinitrobenzene CDNB AR 100 g , Glutathione Reduced GSH 25 g , Two point five percent Glutaraldehyde 500 ml , Diethyl ether AR 1000 ml , Petroleum ether AR grade 2500 ml , Pyrogallol 100 g , Nitric acid 1000 ml , Perchloric acid 1000 ml , Glacial acetic acid 1500 ml , L tryptophan extrapure 100 mg , Barium chloride dehydrate 500 g , Gum acacia 500 g , Magnesium chloride hexahydrate 500 g , Potassium nitrate 500 g , Methyl cellosolve 1000 ml , Citric acid 500 g , Sodium citrate tribasic dehydrate extrapure 98 percent 500 g , Anthrone ACS 98 percent 25 g , N propanol 1000 ml , Ammonium metavanadate 100 g , Phenol crystalline extrapure AR 500 g , Boric acid 500 g , Papain 100 g , Ferric chloride hexahydrate A 100 g , Starch 1000 g , Donepezil hydrochloride 1 , Master mix PCR 100 rxn , DPPH 2 g , ATBS 5 g , CTAB 3 kit , Mcnkey broth 500 g , MHA muller hinton broth 500 g , Sterile disc 2 pack , Plate count agar 500 g , M17 agar 500 g , M17 broth 500 g , Ox bile Ox gall 500 g , MHA agar 500 g , MRS broth 1000 g , MRS agar 1000 g , Pepsin and cysteine 25 g each , X gal 5 bromo 4 chloro 3 indolyl beta D galactopyranoside 1 g , 10 micro leter IPTG iso propylthio beta D galactopyranoside 5 g , Columbia agar 500 g , DNA extraction kit for bacteria 1 pack , Molecular primer 27F 5AGAGTTTGATCCTGGCTCAG 3 and 1492R 5 TACGGTACCTTGTTACGACTT3 , Wurster reagent N N N N tetramethyl pphenylenediamine 10 g , Sucrose lactose maltose glucose fructose xylose sorbitol 500 g each , D Arabinose 100 g , D Reffinose 100 g , Gram staining kit 200 ml reagents , Trypsin 10 g , Nutrient Agar 500 g , Nutrient Broth 500 g

Acetic Acid,Acetone,Acetonitrile,Activated Carbon powder,Ammonium Chloride,Ammonium Hydroxide,Ammon

Himachal Pradesh State Civil Supplies Corporation Limited (hpscsc)

SHIMLA, HIMACHAL PRADESHPosted 4 Aug

GEMGoods4 Documents

Category: Acetic Acid , Acetone , Acetonitrile , Activated Carbon powder , Ammonium Chloride , Ammonium Hydroxide , Ammonium molybedate , Anhudrous monobasic Sodium phosphate , Anhydrous calcium chloride , Anhydrous Sodium Sulphate , Antimony trichloride , Barium Chloride , Barium hydroxide , Benzoic acid , Bromophenol blue indicator , Butanol , Butylated Hydroxytolune , Calcium carbonate , Calcium Chloride , Carbon tetrachloride , Chloroacetic acid , Chloroform , Chromic acid , Copper sulphate pentahydrate , Diethyl ether , Dimethly glyoxime solution , Disidium Hydrogen phosphate , Disodium ethylene diamine tetra acetate dihydrate , Distilled Water , Eriochrome Black T Indicator , Ethanol Pure , Ferric chloride , Ferrous sulphate , Ferrrous ammonium sulphate , Filter paper , Formic acid , Furfural solution , Glacial acetic acid , HPLC Grade water , Hydrochloric acid , Mask , Methanol , Methylene blue Indicator , Murexide , Nitric acid , Orthophosphoric Acid , p-dimethyl amino benzaldehyde , Petroleum ether , Phenolphathelein , Phloroglusinol , Phosphorus pentoxide , Picric acid , Poatassium Iiodate , Potassium aluminium sulphate , Potassium chromate , Potassium Dichromate , Potassium hydroxide , Potassium iodide , Potassium permagnate , Potassium persulphate , Potassium sodium tartrate , Potassium thiocyanate , Salicylic acid , Silver nitrate , Small pumice pieces , Sodium carbonate , Sodium Chloride extra pure , Sodium hydroxide , Sodium thiosulphate pentahydrate , Starch , Sulphuric acid , Surgical gloves , Tartaric acid , Thioglycollic acid , Tissue roll , Trifluoracetic acid , Whatman Filter Paper , Wijs Iodine monochloride , Zinc acetate

Refine Your Search

Quick filters based on popular searches

Popular

Top States

Top Cities

Top Organizations

Sources

Click any filter to narrow down your results • Applied filters shown with opacity

Petri plates,Conical glass flasks,Conical glass flasks,Laboratory tray,Instrument tray,Glass beaker

Indian Council Of Forestry Research And Education (icfre)

SHIMLA, HIMACHAL PRADESHPosted 19 Aug

GEMGoods4 Documents

Category: Petri plates , Conical glass flasks , Laboratory tray , Instrument tray , Glass beakers , Gloves , Blotting sheets , Surgical blades , Aluminum foil , Type 1 creped toilet paper , Glass test tubes , Test tube stand three tier , Potato Dextrose Agar , Ethanol , Copper sulphate , Copper acetate , Labolene Teepol , Sabouraud Dextrose Agar , n-Hexane , Agar Powder Bacteriological , Sodium hydroxide pellets , Potassium hydroxide pellets , Poly ethylene glycol , Chloromphenicol , Silica gel , Bovine serum albumin , Talc , Buffer capsule , Microcrystalline cellulose , Flower Pots Tray , Flower Pots Round , Watering can for gardening

one three Dinitrobenzene,2 2 azino bis 3 Ethylbenzothiazoline 6 sulphonic acid ABTS,2 Propanol,3 5

Central University Of Himachal Pradesh

KANGRA, HIMACHAL PRADESHPosted 19 Nov

GEMGoods3 Documents

Category: one three Dinitrobenzene , 2 2 azino bis 3 Ethylbenzothiazoline 6 sulphonic acid ABTS , 2 Propanol , 3 5 Dimethoxy 4 hydroxyacetophenone Acetosyringone , Acetone , Acetic Acid Glacial , Acetonitrile , Acrylamide , Activated Charcoal powder , Aluminium potassium sulphate dodecahydrate Potash Alum , Ammonia Solution Ammonium Hydroxide , Ammonium chloride , Ancymidol , Andrographolide , Bismuth III subnitrate , Bromine Water , Bromocresol Green , Bromocresol purple , Carboxymethyl cellulose sodium salt , Chitin , Chitosan , Chloroform , Citric Acid monohydrate , Curzerenone , Dextrose D plus Glucose anhydrous , Diethylene glycol , DMSO , DPPH 2 2 Diphenyl 1 picrylhydrazyl , Dragendorff s Reagent , Ethanol , Ethyl Acetate , Ethylene Glycol , Ferrous chloride tetra hydrate , Formaldehyde , Glycerol , Hydrochloric Acid , Hydrogen Peroxide , Hyperoside , Jasmonic Acid , lactic acid , L Ascorbic acid , Litmus solution blue , Litmus solution Red , Luria Bertani Agar Miller Miller Luria Bertani Agar , Luria Bertani Broth Miller Miller Luria Bertani Broth , Mercuric Chloride , Methanol , Methyl orange , Methyl red , Millons Reagent , Molisch Reagent , Mueller Hinton Agar , Mueller Hinton Broth , Murashige and Skoog media wCaCl2 and vitamins and sucrose wo agar , Murashige and Skoog Medium w CaCl2 and Vitamins wo Sucrose and Agar , Murashige and Skoog Microelements solution 100X , Murashige and Skoog Vitamins 1000x , Murashige and SkoogMacroelements Solution 10X , n butanol , Neoandrographolide , n Hexane , Ninhydrin , Nitric Acid , n propanol , Paclobutrazol , Perchloric Acid , Petroleum Ether , Phenol Crystal , Phenolphthalein , Potassium dichromate , Potassium Iodide , Potassium permanganate , Quercetin , Rottlerin , Silica Gel G for TLC , Silver Nitrate , Sodium bicarbonate , Sodium bisulphite , Sodium Carbonate anhydrous , Sodium chloride , Sodium Hydroxide , Sodium lactate , sodium nitroprusside solution , Sucrose , Sulphuric Acid , Tartaric acid , Toluene , Tween 80 , Universal Indicator solution , Wagner reagent , Xylene , Agarose , Ammonium Acetate , Ammonium persulphate , Isoamyl Alcohol , Boric Acid , Bromophenol Blue , Coomassie Briliant Blue , CTAB N Cetyl N N N trimethylammonium bromide buffer , DNA Polymerase with standard Taq Buffer with MG2 plus , dNTPs , Ethidium Bromide , Polyvinylpyrrolidone , TEMED , Tris HCl , Xylene cyanol , Urea , Acryl 29 ratio 1 3dot 3 cross linker , 10X TBE solution , Phenol , MgCl2 , DNA Ladder , Protein markers , Primers forward n reverse , Plant Genomic DNA isolation Teaching Kits , RNA extraction Teaching Kits , PCR Teaching Kits , Diphenyl amine reagent , Saline citrate buffer pH 7 , DEPEC water , RNA Ladder , DNA Amplification Universal Primers , Diluent for DNA Extraction

Aluminium Sulphate 500 gm,Acetamide 500 ml,Ammonia Solution 2500 ml,Anthracene 500 gm,Barfoed Reage

Higher Education Department

HAMIRPUR, HIMACHAL PRADESHPosted 20 Dec

GEMGoods3 Documents

Category: Aluminium Sulphate 500 gm , Acetamide 500 ml , Ammonia Solution 2500 ml , Anthracene 500 gm , Barfoed Reagent 125 ml , Benedicts Solution 500 ml , Benzaldehyde 500 ml , Benzoyl Peroxide 500 gm , Biphenyl 500 gm , Bromine Water 1000 ml , Butanol 500 gm , Calcium Oxide 500 gm , Carbon Disulphide 500 ml , Cellulose Powder 500 gm , Chlorine Water 500 ml , Citric Acid 500 gm , D Fructose 500 gm , D Glucose 500 gm , Di Chloromethane 500 gm , Diethyl Ether 500 ml , Dimethyl Aniline 500 gm , 2 4 Dinitro Phenyl Hydrazine 500 gm , Fehling Solution A 500 ml , Fehling Solution B 500 ml , Formic Acid 500 ml , Glycerol 500 ml , Iodine 500 gm , Lead Nitrate 500 gm , Liquid Bromine 500 ml , Litmus Blue Solution 125 ml , Lactose 500 gm , Maltose 250 gm , Methanol 2500 ml , Methyl Acetate 500 ml , N Nitroaniline 500 gm , Oil Bath 1 pc , Petroleum Ether 500 ml , Phenol 500 gm , Phenolpthlein Solution 500 ml , Phenyl Hydrazine 500 ml , P Nitro Phenol 500 ml , P Nitro Aniline 500 gm , Potassium Sodium Tartrate 500 gm , Resoruinal 500 ml , Schiffs Reagent 500 ml , Silver Nitrate 25 gm , Sodium Chloride 500 gm , Sodium Bisulphite 500 gm , Thiourea 500 gm , Ammonium Hydroxide 500 gm , Disodium Hydrogen Phosphate 500 gm , Potassium Pyroantimonate 500 gm , Pyridine 1000 ml , Ammonium Persulphate 500 gm , Lead Dioxide 500 gm , Cobalt Chloride Hexahydrade 500 gm

Ba Acetate,2-ethyl hexanoic acid,Tetra-n-butyle-orthotitanate,Polyvinylpyrrolidone,Molybdenum V chl

Organization Not Specified

KANGRA, HIMACHAL PRADESHPosted 28 Jan

GEMGoods4 Documents