TenderDekho Logo
Amyl Alcohol state-wide in Himachal Pradesh

Amyl Alcohol Tenders in Himachal Pradesh

Explore state-wide amyl alcohol procurement opportunities in Himachal Pradesh. Track active bids, eligibility criteria, and deadlines for this state.

Location
Authority
0

Potassium hydroxide 1000 g,4 percent Paraformaldehyde 500 ml,Phenol chloroform isoamyl alcohol 300

Central University Of Himachal Pradesh

KANGRA, HIMACHAL PRADESHPosted 26 Mar
GEMGoods3 Documents
Category: Potassium hydroxide 1000 g , 4 percent Paraformaldehyde 500 ml , Phenol chloroform isoamyl alcohol 300 ml , Sodium carbonate 500 g , Thiobarbituric acid 125 g , Sodium hydroxide 1000 g , Superoxide Dismutase antioxidant assay kit calorimetric 1 , Riboflavin 100 g , Trypan Blue zero point four percent Solution 50 ml , Guaiacol 250 g , Iron chloride FeCl3 100 g , Potassium Ferricyanide 100 g , Iodine 100 g , Dichloromethane 100 ml , Iron sulfate FeSO4 500 g , Sodium Hypochlorite NaOCl 500 ml , Perchloric Acid HClO4 500 ml , Zinc Chloride ZnCl2 500 g , Sodium Iodide NaI 500 g , Phosphate Buffer 500 ml , DNA Extraction Kit for Animal tissue 2 , PCR kit 2 , PBS Phosphate buffered saline 1000 ml , Sodium Chloride 1000 g , Bouins fixative 500 ml , Bradford reagent 1000 ml , ALT Activity kit Calorimetric 50 rxn , AST Activity kit Calorimetric 50 rxn , ALP Activity kit Calorimetric 50 rxn , Giemsa stain 50 ml , Ethanol 15 L , Nitroblue tetrazolium NBT 25 g , S Acetylthiocholine iodide 25 g , Potassium cyanide 500 g , Drabkins reagent 500 ml , Hayemis RBC diluting fluid 100 ml , Turks WBC diluting fluid 100 ml , Heparin anticoagulant 50 ml , Hydrogen peroxide 1500 ml , 1 Chloro2 4 Dinitrobenzene CDNB AR 100 g , Glutathione Reduced GSH 25 g , Two point five percent Glutaraldehyde 500 ml , Diethyl ether AR 1000 ml , Petroleum ether AR grade 2500 ml , Pyrogallol 100 g , Nitric acid 1000 ml , Perchloric acid 1000 ml , Glacial acetic acid 1500 ml , L tryptophan extrapure 100 mg , Barium chloride dehydrate 500 g , Gum acacia 500 g , Magnesium chloride hexahydrate 500 g , Potassium nitrate 500 g , Methyl cellosolve 1000 ml , Citric acid 500 g , Sodium citrate tribasic dehydrate extrapure 98 percent 500 g , Anthrone ACS 98 percent 25 g , N propanol 1000 ml , Ammonium metavanadate 100 g , Phenol crystalline extrapure AR 500 g , Boric acid 500 g , Papain 100 g , Ferric chloride hexahydrate A 100 g , Starch 1000 g , Donepezil hydrochloride 1 , Master mix PCR 100 rxn , DPPH 2 g , ATBS 5 g , CTAB 3 kit , Mcnkey broth 500 g , MHA muller hinton broth 500 g , Sterile disc 2 pack , Plate count agar 500 g , M17 agar 500 g , M17 broth 500 g , Ox bile Ox gall 500 g , MHA agar 500 g , MRS broth 1000 g , MRS agar 1000 g , Pepsin and cysteine 25 g each , X gal 5 bromo 4 chloro 3 indolyl beta D galactopyranoside 1 g , 10 micro leter IPTG iso propylthio beta D galactopyranoside 5 g , Columbia agar 500 g , DNA extraction kit for bacteria 1 pack , Molecular primer 27F 5AGAGTTTGATCCTGGCTCAG 3 and 1492R 5 TACGGTACCTTGTTACGACTT3 , Wurster reagent N N N N tetramethyl pphenylenediamine 10 g , Sucrose lactose maltose glucose fructose xylose sorbitol 500 g each , D Arabinose 100 g , D Reffinose 100 g , Gram staining kit 200 ml reagents , Trypsin 10 g , Nutrient Agar 500 g , Nutrient Broth 500 g
Deadline
16 Apr 2025
View Details

En Gen Mutation Detection Kit,RNase ZAP,Diethylpyrocarbonate,Recombinant Proteinase K Solution,Phos

Indian Council Of Agricultural Research (icar)

SHIMLA, HIMACHAL PRADESHPosted 25 Sept
EMD: ₹32,000
GEMGoods3 Documents
Category: En Gen Mutation Detection Kit , RNase ZAP , Diethylpyrocarbonate , Recombinant Proteinase K Solution , Phosphate-Buffered , HEPES for molecular biology Bio Ultra , Phenol Chloroform Isoamyl Alcohol , Cefotaxime , Tri Reagent for RNA isolation , Chloroform saturated with ethanol , Phenol solution , Dnase I Amplification grade , Evans Blue , Corning cell strainer , First strand cDNA synthesis kit
Deadline
16 Oct 2025
View Details

one three Dinitrobenzene,2 2 azino bis 3 Ethylbenzothiazoline 6 sulphonic acid ABTS,2 Propanol,3 5

Central University Of Himachal Pradesh

KANGRA, HIMACHAL PRADESHPosted 19 Nov
₹5.0 L
GEMGoods3 Documents
Category: one three Dinitrobenzene , 2 2 azino bis 3 Ethylbenzothiazoline 6 sulphonic acid ABTS , 2 Propanol , 3 5 Dimethoxy 4 hydroxyacetophenone Acetosyringone , Acetone , Acetic Acid Glacial , Acetonitrile , Acrylamide , Activated Charcoal powder , Aluminium potassium sulphate dodecahydrate Potash Alum , Ammonia Solution Ammonium Hydroxide , Ammonium chloride , Ancymidol , Andrographolide , Bismuth III subnitrate , Bromine Water , Bromocresol Green , Bromocresol purple , Carboxymethyl cellulose sodium salt , Chitin , Chitosan , Chloroform , Citric Acid monohydrate , Curzerenone , Dextrose D plus Glucose anhydrous , Diethylene glycol , DMSO , DPPH 2 2 Diphenyl 1 picrylhydrazyl , Dragendorff s Reagent , Ethanol , Ethyl Acetate , Ethylene Glycol , Ferrous chloride tetra hydrate , Formaldehyde , Glycerol , Hydrochloric Acid , Hydrogen Peroxide , Hyperoside , Jasmonic Acid , lactic acid , L Ascorbic acid , Litmus solution blue , Litmus solution Red , Luria Bertani Agar Miller Miller Luria Bertani Agar , Luria Bertani Broth Miller Miller Luria Bertani Broth , Mercuric Chloride , Methanol , Methyl orange , Methyl red , Millons Reagent , Molisch Reagent , Mueller Hinton Agar , Mueller Hinton Broth , Murashige and Skoog media wCaCl2 and vitamins and sucrose wo agar , Murashige and Skoog Medium w CaCl2 and Vitamins wo Sucrose and Agar , Murashige and Skoog Microelements solution 100X , Murashige and Skoog Vitamins 1000x , Murashige and SkoogMacroelements Solution 10X , n butanol , Neoandrographolide , n Hexane , Ninhydrin , Nitric Acid , n propanol , Paclobutrazol , Perchloric Acid , Petroleum Ether , Phenol Crystal , Phenolphthalein , Potassium dichromate , Potassium Iodide , Potassium permanganate , Quercetin , Rottlerin , Silica Gel G for TLC , Silver Nitrate , Sodium bicarbonate , Sodium bisulphite , Sodium Carbonate anhydrous , Sodium chloride , Sodium Hydroxide , Sodium lactate , sodium nitroprusside solution , Sucrose , Sulphuric Acid , Tartaric acid , Toluene , Tween 80 , Universal Indicator solution , Wagner reagent , Xylene , Agarose , Ammonium Acetate , Ammonium persulphate , Isoamyl Alcohol , Boric Acid , Bromophenol Blue , Coomassie Briliant Blue , CTAB N Cetyl N N N trimethylammonium bromide buffer , DNA Polymerase with standard Taq Buffer with MG2 plus , dNTPs , Ethidium Bromide , Polyvinylpyrrolidone , TEMED , Tris HCl , Xylene cyanol , Urea , Acryl 29 ratio 1 3dot 3 cross linker , 10X TBE solution , Phenol , MgCl2 , DNA Ladder , Protein markers , Primers forward n reverse , Plant Genomic DNA isolation Teaching Kits , RNA extraction Teaching Kits , PCR Teaching Kits , Diphenyl amine reagent , Saline citrate buffer pH 7 , DEPEC water , RNA Ladder , DNA Amplification Universal Primers , Diluent for DNA Extraction
Deadline
10 Dec 2025
View Details

MRS agar,MRS broth,Proteinase K,Rnase,Isopropanol,Amoxycillin,Chloramphenicol,Tetracycline,Erythrom

Central University Of Himachal Pradesh

KANGRA, HIMACHAL PRADESHPosted 13 Jan
₹4.8 L
GEMGoods4 Documents
Category: MRS agar , MRS broth , Proteinase K , Rnase , Isopropanol , Amoxycillin , Chloramphenicol , Tetracycline , Erythromycin , Master mix , Phenol chloroform isoamyl alcohol , n- Hexadecane , Resazurin dye , Sucrose and Lactose , Molecular primer , Skimmed milk agar , Litmus Skim milk broth , 2 2 azino bis 3 ethylbenzothiazoline 6 sulfonic acid ABTS , Spirit , Ethanol , Tetrahydrofuran , Mineral Salt agar , Minimal Broth w o Dextrose , Oxidase discs , Urease discs , Nitrate reagent Discs Twin pack , HiIMViC Biochemical test kit , Alamar Blue Reagent , Solasodine, C27H43NO2 95percent Purity HPLC grade , solanine C45H73NO15 95percent Purity HPLC grade , Vitexin C21H20O10 95percent Purity HPLC grade , Luteolin C15H10O6 95percent Purity HPLC grade , Benzaldehyde , N amyl acetate , 2 7 dichlorofluoroescein , Glycerol , Polyvinyl chloride , 2 3 5 triphenyltetrazolium chloride , Acetic acid , Antimony trichloride , Ethyl acetate , Sodium iodide , Sodium hydroxide , Potassium hydroxide , Ferric alpha alpha dipyridyl reagent , HPLC grade Ethanol 100 percent , Dulbeccos Modified Eagle Medium DMEM High Glucose , Dulbeccos Modified Eagle Medium DMEM Low Glucose , RPMI , DMSO Dimethyl Sulfoxide , Fetal Bovine Serum FBS , Trypsin , DCFH DA 2 7 Dichlorofluorescein diacetate , Methanol , Phosphate Buffered Saline PBS , Penicillin Powdered form , Streptomycin Powdered form , Vancomycin Powdered form , Tetracycline Powdered form , Azithromycin Powdered form , Clindamycin Powdered form , High capacity cDNA reverse transcriptase kit 50 reaction , RNA Isolation Kit 50 rxn , MTT powder , MH agar , MH broth , Nutrient broth , Nutrient agar media , TRIzol , Myrcene , Putrescine , Trimethylamine , Ethyl Butyrate , Limonene , CMC Agar Salt , Bacteria g DNA Isolation Kit Purification Genomic , Xylan , Lignin
Deadline
3 Feb 2026
View Details
Chat with us