TenderDekho Logo
Glass Staining Dishes state-wide in Himachal Pradesh

Glass Staining Dishes Tenders in Himachal Pradesh

Explore state-wide glass staining dishes procurement opportunities in Himachal Pradesh. Major buyers include Central University Of Himachal Pradesh. Tender values range from ₹Infinity Cr to ₹-InfinityK. EMD ranges from ₹Infinity Cr to ₹-InfinityK. Procurement sources: Gem (1). Track active bids, eligibility criteria, and deadlines for this state.

Live Opportunities
National Reach
0

Potassium hydroxide 1000 g,4 percent Paraformaldehyde 500 ml,Phenol chloroform isoamyl alcohol 300

Central University Of Himachal Pradesh

KANGRA, HIMACHAL PRADESHPosted 26 Mar
GEMGoods3 Documents
Category: Potassium hydroxide 1000 g , 4 percent Paraformaldehyde 500 ml , Phenol chloroform isoamyl alcohol 300 ml , Sodium carbonate 500 g , Thiobarbituric acid 125 g , Sodium hydroxide 1000 g , Superoxide Dismutase antioxidant assay kit calorimetric 1 , Riboflavin 100 g , Trypan Blue zero point four percent Solution 50 ml , Guaiacol 250 g , Iron chloride FeCl3 100 g , Potassium Ferricyanide 100 g , Iodine 100 g , Dichloromethane 100 ml , Iron sulfate FeSO4 500 g , Sodium Hypochlorite NaOCl 500 ml , Perchloric Acid HClO4 500 ml , Zinc Chloride ZnCl2 500 g , Sodium Iodide NaI 500 g , Phosphate Buffer 500 ml , DNA Extraction Kit for Animal tissue 2 , PCR kit 2 , PBS Phosphate buffered saline 1000 ml , Sodium Chloride 1000 g , Bouins fixative 500 ml , Bradford reagent 1000 ml , ALT Activity kit Calorimetric 50 rxn , AST Activity kit Calorimetric 50 rxn , ALP Activity kit Calorimetric 50 rxn , Giemsa stain 50 ml , Ethanol 15 L , Nitroblue tetrazolium NBT 25 g , S Acetylthiocholine iodide 25 g , Potassium cyanide 500 g , Drabkins reagent 500 ml , Hayemis RBC diluting fluid 100 ml , Turks WBC diluting fluid 100 ml , Heparin anticoagulant 50 ml , Hydrogen peroxide 1500 ml , 1 Chloro2 4 Dinitrobenzene CDNB AR 100 g , Glutathione Reduced GSH 25 g , Two point five percent Glutaraldehyde 500 ml , Diethyl ether AR 1000 ml , Petroleum ether AR grade 2500 ml , Pyrogallol 100 g , Nitric acid 1000 ml , Perchloric acid 1000 ml , Glacial acetic acid 1500 ml , L tryptophan extrapure 100 mg , Barium chloride dehydrate 500 g , Gum acacia 500 g , Magnesium chloride hexahydrate 500 g , Potassium nitrate 500 g , Methyl cellosolve 1000 ml , Citric acid 500 g , Sodium citrate tribasic dehydrate extrapure 98 percent 500 g , Anthrone ACS 98 percent 25 g , N propanol 1000 ml , Ammonium metavanadate 100 g , Phenol crystalline extrapure AR 500 g , Boric acid 500 g , Papain 100 g , Ferric chloride hexahydrate A 100 g , Starch 1000 g , Donepezil hydrochloride 1 , Master mix PCR 100 rxn , DPPH 2 g , ATBS 5 g , CTAB 3 kit , Mcnkey broth 500 g , MHA muller hinton broth 500 g , Sterile disc 2 pack , Plate count agar 500 g , M17 agar 500 g , M17 broth 500 g , Ox bile Ox gall 500 g , MHA agar 500 g , MRS broth 1000 g , MRS agar 1000 g , Pepsin and cysteine 25 g each , X gal 5 bromo 4 chloro 3 indolyl beta D galactopyranoside 1 g , 10 micro leter IPTG iso propylthio beta D galactopyranoside 5 g , Columbia agar 500 g , DNA extraction kit for bacteria 1 pack , Molecular primer 27F 5AGAGTTTGATCCTGGCTCAG 3 and 1492R 5 TACGGTACCTTGTTACGACTT3 , Wurster reagent N N N N tetramethyl pphenylenediamine 10 g , Sucrose lactose maltose glucose fructose xylose sorbitol 500 g each , D Arabinose 100 g , D Reffinose 100 g , Gram staining kit 200 ml reagents , Trypsin 10 g , Nutrient Agar 500 g , Nutrient Broth 500 g
Deadline
16 Apr 2025
View Details