TenderDekho Logo
Niger Category

Niger Tenders - Government Procurement Opportunities

Explore niger tenders from government buyers across India. Major buyers include Indian Council Of Agricultural Research (icar) and Central University Of Haryana. Combined opportunity value of ₹11.8 lakh

National Reach
Major Buyer
0

No Active Tenders Available

Showing past tenders for your reference. Check back regularly for new opportunities.

Want to be notified when new Niger tenders are posted?

Set Up Alert

Acetic acid solution 45754-500ML-F 500 ml,Dimethyl sulfoxide 34869-500ML 500 ml,Formic acid 98 perc

Indian Council Of Agricultural Research (icar)

SOLAPUR, MAHARASHTRAPosted 14 Mar
GEMGoods4 Documents
Category: Acetic acid solution 45754-500ML-F 500 ml , Dimethyl sulfoxide 34869-500ML 500 ml , Formic acid 98 percent - 100 percent 5.43804 100 ml , Gallic acid 91215 100 mg , Glucose GO Assay Kit GAGO20 1 Kit , Pepsin from porcine gastric mucosa P7000-25G 25 g , Pancreatin from porcine pancreas P1750-25G 100 g , Amyloglucosidase from Aspergillus niger 10115-1G-F 1 g , a-Amylase from porcine pancreas A3176-500KU 500 KU , a-Glucosidase from Saccharomyces cerevisiae G5003-100UN 100 UN , 3,5- Dinitrosalicylic acid 128848-5G 5 G , Starch, soluble S9765- 100G 100 G , 4-Nitrophenyl B-D-glucopyranoside N7006- 500MG 500 MG , Sodium Phosphate, Monobasic 567545- 1KG 1 KG , Sodium phosphate dibasic S9763-1KG 1 KG , Acarbose A8980-1G 1 G , a-Amylase from porcine pancreas A3176-500KU 500KU , a-Glucosidase from Saccharomyces cerevisiae G5003-100UN 100UN , 3,5-Dinitrosalicylic acid 128848-5G 5G , Starch, soluble S9765-100G 100G , 4- Nitrophenyl B-D-glucopyranoside N7006-500MG 500MG , Sodium Phosphate, Monobasic 567545-1KG 1KG , Sodium phosphate dibasic S9763-1KG 1KG , Acarbose A8980-1G 1G , Punicalin A plus B mixture PHL83532-10MG 10 mg , plus - Catechin hydrate C1251-5G 5 g , Caffeic acid C0625-2G 2 g , minus Epicatechin E1753-1G 1 g , Rutin PHL89270-50MG 50 mg , Ellagic acid E2250-1G 1 g , Kaempferol 60010-25MG 25 mg , Quercetin 3-glucoside 16654-10MG 10 mg , p- Coumaric acid C9008-1G 1 g , Cyanidin 3-glucoside chloride PHL89616-10MG 10 mg , Cynadin 3,5-diglucoside chloride PHL89615-10MG 10 mg , Pelargonidin 3-diglucoside chloride PHL89753-10MG 10 mg , Pelargonidin 3,5-diglucoside chloride PHL80334-10MG 10 mg , Liquid scintillation vials, plastic V6880-500EA 500 ea , Nordihydroguaiaretic acid, greater than or equl to 97.0 percent HP and 74540-5G 5G
Deadline
4 Apr 2025
View Details

Refine Your Search

Quick filters based on popular searches

Popular
Top States
Top Cities
Top Organizations
Sources

Click any filter to narrow down your results • Applied filters shown with opacity

IIOR Annual Report 2025,Newsletter 2025 Issue 1,Newsletter 2025 Issue 2,Newsletter 2025 Issue 3,New

Indian Council Of Agricultural Research (icar)

HYDERABAD, TELANGANAPosted 6 May
EMD: ₹50,000
GEMGoods3 Documents
Category: IIOR Annual Report 2025 , Newsletter 2025 Issue 1 , Newsletter 2025 Issue 2 , Newsletter 2025 Issue 3 , Newsletter 2025 Issue 4 , Technical compendium ICAR IIOR , Technical compendium AICRP on Oilseeds Castor , Technical compendium AICRP on Oilseeds Sunflower , Technical compendium AICRP on Oilseeds Linseed , Technical compendium AICRP on Oilseeds Safflower , Annual Report AICRP on Oilseeds Castor , Annual Report AICRP on Oilseeds Sunflower , Annual Report AICRP on Oilseeds Safflower , Annual Report AICRP on Oilseeds Linseed , Directors Report for Sunflower and Castor , Directors Report for Safflower and Linseed , AGM Proceedings of Sunflower and Castor , AGM Proceedings of Safflower and Linseed , Descriptors for mandated oilseed crops sunflower of ICAR-IIOR , Value addition in oilseeds Book , Sunflower Value addition Bulletin , Descriptors for mandated oilseed crops sesame , Descriptors for mandated oilseed crops niger , Descriptors for mandated oilseed crops linseed , Descriptors for mandated oilseed crops castor , ICAR-IIOR at a glance , Storage losses in oilseeds Bulletin , Safflower germplasm catalogue , Varieties and Hybrids of Safflower , Interactive Sunflower Mobile App English , Interactive Sunflower Mobile App Telugu , Interactive Sunflower Mobile App Hindi , Interactive castor Mobile App English , Interactive Castor Mobile App Hindi , Interactive castor Mobile App Telugu , Insect pest of Castor and their Management , Good Agricultural Practices in Oilseed crops , Insect pests of Sesame and their management , Insect pests of Linseed and their management , A Practical manual on Microbial Biopesticides , Management of Diseases of Castor , Management of Insect Pests and Diseases of Castor , Frontline Demonstrations on Oilseeds , Bee keeping in sunflower Bulletin
Deadline
27 May 2025
View Details

Diamond Sugar Pills,Aconitum Napellus,Actea Racemosa,Aesculus hippocastanum,Agaricus muscarius,Aloe

Homoeopathy Directorate Government Of Uttar Pradesh

SULTANPUR, UTTAR PRADESHPosted 10 Jul
EMD: ₹58,000
GEMGoods4 Documents
Category: Diamond Sugar Pills , Aconitum Napellus , Actea Racemosa , Aesculus hippocastanum , Agaricus muscarius , Aloe socotrina , Alumina , Ammonium carbonicum , Anacardium orientale , Aurum Metallicum , Antimonium crudum , Antimonium tartaricum , Apis mellifica , Argentum nitricum , Benzoic acid , Berberis vulgaris , Baptisia tinctoria , Borax , Bromium , Calcarea carbonica , Calcarea fluorica , Causticum , Chamomilla , China , Conium maculatum , Dulcamara , Drosera rotundifolia , Echinacea angustifolia , Eupatorium perfoliatum , Ferrum metallicum , Gelsemium sempervirens , Glonoinum , Graphites , Guaiacum , Hydrastis canadensis , Hydrocotyle asiatica , Hypericum perforatum , Ignatia amara , Ipecacuanha , Kreosotum , Lachesis , Ledum palustre , Lycopodium clavatum , Mezereum , Mercurius solubilis , Natrum muriaticum , Natrum phosphoricum , Natrum sulphuricum , Nux vomica , Ocimum sanctum , Petroleum , Phosphorus , Pulsatilla nigricans , Phytolacca , Plantago major , Rhus toxicodendron , Rhododendron chrysanthemum , Ruta graveolens , Sabina , Sepia , Sabal serrulata , Silicea , Sulphur , Tellurium , Thyroidinium , Thuja occidentalis , Urtica urens , Veratrum album , Viburnum Opulus , Zincum metallicum , Cina , Carbo Veg , Cantharis , Actea racemosa , Bacillinum , China officinalis , Colchicum autumnale , Colocynthis , Crataegus , Cuprum metallicum , Gun Powder , Helleborus niger , Hydrangia , Hyoscyamus niger , Iodium , Kali carbonicum , Kali iodatum , Lac caninum , Lachnanthis , Magnesium phosphoricum , Nitric acid , Opium , Ranunculus bulbosus , Selenium , Trillium pendulum , BKS EUPHRASIA EYE DROP , Ferrum phos , Calcarea phosphoricum , Berberis Aquifolium , Hamamelis virginica , Calendula officinalis , BKS ALFALFA TONIC , BKS GASTRO AID SYRUP , BKS LIV AID SYRUP , BKS BEE PEE AID , BKS DIAB AID , BKS RHEUM AID OIL , BKS PROSTATE AID , BKS KOF AID SYRUP , BKS FERRUM PLUS , BKS MENSO AID SYRUP , Acid Phos , Avena sativa , Berberis Aquafolium , Chelidonium , China Off , Syzygium jambolanum , Rauwolfia serpentina , Justicia , Jaborandi , Hydrangea
Deadline
25 Jul 2025
View Details

Diamond Sugar Pills,Aconitum Napellus,Actea Racemosa,Aesculus hippocastanum,Agaricus muscarius,Aloe

Homoeopathy Directorate Government Of Uttar Pradesh

SULTANPUR, UTTAR PRADESHPosted 30 Jul
EMD: ₹58,000
GEMGoods4 Documents
Category: Diamond Sugar Pills , Aconitum Napellus , Actea Racemosa , Aesculus hippocastanum , Agaricus muscarius , Aloe socotrina , Alumina , Ammonium carbonicum , Anacardium orientale , Aurum Metallicum , Antimonium crudum , Antimonium tartaricum , Apis mellifica , Argentum nitricum , Benzoic acid , Berberis vulgaris , Baptisia tinctoria , Borax , Bromium , Calcarea carbonica , Calcarea fluorica , Causticum , Chamomilla , China , Conium maculatum , Dulcamara , Drosera rotundifolia , Echinacea angustifolia , Eupatorium perfoliatum , Ferrum metallicum , Gelsemium sempervirens , Glonoinum , Graphites , Guaiacum , Hydrastis canadensis , Hydrocotyle asiatica , Hypericum perforatum , Ignatia amara , Ipecacuanha , Kreosotum , Lachesis , Ledum palustre , Lycopodium clavatum , Mezereum , Mercurius solubilis , Natrum muriaticum , Natrum phosphoricum , Natrum sulphuricum , Nux vomica , Ocimum sanctum , Petroleum , Phosphorus , Pulsatilla nigricans , Phytolacca , Plantago major , Rhus toxicodendron , Rhododendron chrysanthemum , Ruta graveolens , Sabina , Sepia , Sabal serrulata , Silicea , Sulphur , Tellurium , Thyroidinium , Thuja occidentalis , Urtica urens , Veratrum album , Viburnum Opulus , Zincum metallicum , Cina , Carbo Veg , Cantharis , Actea racemosa , Bacillinum , China officinalis , Colchicum autumnale , Colocynthis , Crataegus , Cuprum metallicum , Gun Powder , Helleborus niger , Hydrangia , Hyoscyamus niger , Iodium , Kali carbonicum , Kali iodatum , Lac caninum , Lachnanthis , Magnesium phosphoricum , Nitric acid , Opium , Ranunculus bulbosus , Selenium , Trillium pendulum , BKS EUPHRASIA EYE DROP , Ferrum phos , Calcarea phosphoricum , Berberis Aquifolium , Hamamelis virginica , Calendula officinalis , BKS ALFALFA TONIC , BKS GASTRO AID SYRUP , BKS LIV AID SYRUP , BKS BEE PEE AID , BKS DIAB AID , BKS RHEUM AID OIL , BKS PROSTATE AID , BKS KOF AID SYRUP , BKS FERRUM PLUS , BKS MENSO AID SYRUP , Acid Phos , Avena sativa , Berberis Aquafolium , Chelidonium , China Off , Syzygium jambolanum , Rauwolfia serpentina , Justicia , Jaborandi , Hydrangea
Deadline
14 Aug 2025
View Details

BSTFA with 1 TMCS,Pyridine 100 mL,Cellulase fromTrichoderma sp,Hemicellulase fromAspergillus niger,

Indian Council Of Agricultural Research (icar)

KOZHIKODE, KERALAPosted 15 Oct
GEMGoods4 Documents
Category: BSTFA with 1 TMCS , Pyridine 100 mL , Cellulase fromTrichoderma sp , Hemicellulase fromAspergillus niger , Pellitorine , Linalool , Alpha terpinyl acetat , 1 8cineole , Trans beta caryophyllene , R Limonene , Alpha terpineol , Trans nerolidol , Sabinene hydrate , Alpha pinene , Beta pinene , Beta myrcene , Sabinene , Alpha phellandrene , Trans cinnamaldehyde
Deadline
5 Nov 2025
View Details

Custom DNA Synthesis of Primers 25 nmol,Prime Script 1st strand cDNA Synthesis Kit 50 reactions,TB

Indian Council Of Agricultural Research (icar)

NAINITAL, UTTARAKHANDPosted 13 Oct
₹17.0 L
GEMGoods3 Documents
Category: Custom DNA Synthesis of Primers 25 nmol , Prime Script 1st strand cDNA Synthesis Kit 50 reactions , TB Green Pre Mix Ex Taq II Tli RNAse H Plus , RNAiso plus Total RNA extraction reagent , Amylase from Bacillus licheniforms , Amyloglucosidase from Aspergillus niger lyophilized Powder 70 U mg , Glucose Oxidase form Aspergillus niger type VII lyophilized powder 100000 units g solid without added oxygen , Peroxidase from horseradish type II essentially salt free lyophilized powder 150 250 units mg solid using pyrogallol , Primers Forward Revers Total Base 1249 , Fish Immunoglobulin M Ig ELISA kit 96T , Superoxide Dismutase SOD ELISA kit , Fish lysozyme renal amyloidosis LZM ELISA kit , Fish Interleukin 6 IL 6 ELISA Kit , Fish Cortisol ELISA Kit , Forward Primers , Reverse Primer , Taq DNA Polymerase , EZAssay Antioxidant activity estimation kit CUPRAC 200 tests , Azo M Protein Azo Casein , EZdetect PCR kit for Mycoplasma detection Based on 16S 23S rRNA spacer region , Trypsin inhibitor powder source Soyabean Cell culture tested Activity 7000BAEE units of inhibition mg , COIF1 5TCAACCAACCACAAGACATTGGCAC3 26 nucleotides , COIR1 5TAGACTTCTGGGTGCCAAAGAATCA3 26 nucleotides , M151 5AACCCGGCTTTCGGCAGCA3 20 nucleotides , M152 5CGGGGCGGGGTTGTGAGAT3 20 nucleotides , IHN UP F 5AGAGATCCCTACACCAGAGAC 3 21 nucleotides , IHN UP R 5AGAGATCCCTACACAGAGAC 3 21 nucleotides , VN F 5ATGGAAGGAGGAATCGTGAAGCG 3 24 nucleotides , VN R 5 GCGGTGAAGTGCTCAGTTCCC 3 22 nucleotides , IPN F 5 GTGCTGGCCACAACGACAAC 3 21 nucleotides , IPN R 5 AATTGGTCTGCCGTTCCTA 3 19 nucleotides , ISAoic F 5 GGCTATCTACCAT AACGAAT 3 21 nucleotides , ISAoic R 5 GCCAAGTGTAAGTGCACTCC 3 21 nucleotides , Bench Top 1kb DNA Ladder , Bench Top 100bp DNA Ladder , Bench Top PCR Marker , Taq DNA Polymerase recombinant 5U uL , Quick CIP 1000 units with buffer , T4 DNA Ligase 20000 units , ProtoScript II First Strand cDNA Synthesis Kit 30 reactions , Q5 High Fidelity 2X Master Mix 100 reactions , OneTaq 2X Master Mix with Standard Buffer 100 reactions , Synthetic peptides , SpectraDrop 24 Kit , Easy Yeast Plasmid Isolation Kit 50 rxns , Quick Easy Yeast Transformation Mix 20rxn , Western BLoT Immuno Booster PF 250ml , Western BLoT Blocking Buffer Protein Free 500ml , FastDigest ApaI 300rxn , FastDigest BamHI 800rxn , FastDigest BgIII 100rxn , FastDigest EcoRI 800rxn , FastDigest EcoRV Eco32I 200 rxn , FastDigest HindIII 800rxn , FastDigest KpnI 300rxn , FastDigest NcoI 20rxn , FastDigest Ndel 100 rxn , FastDigest Nhel 50 rxn , FastDigest Notl 50 rxn , FastDigest SaII 200rxn , FastDigest SmaI 100 rxn , FastDigest SacI 100 rxn , FastDigest XbaI 300 rxn , FastDigest XhoI 400 rxn , FastDigest value pack , Synthetic peptide , MRGSH 011FW , MRGSH 011RV , SHRV 1 F , SHRV 1 R , SHRV 2 F , SHRV 2 R , SHRV IPC2 fwd , SHRV IPC2 rev , Bacterial Genome Sequencing
Deadline
10 Nov 2025
View Details

Title1,Title2,Title3,Title4,Title5,Title6,Title7,Title8,Title9,Title10,Title11,Title12,Title13,Titl

Central University Of Haryana

MAHENDRAGARH, HARYANAPosted 2 Dec
GEMGoods3 Documents
Category: Title1 , Title2 , Title3 , Title4 , Title5 , Title6 , Title7 , Title8 , Title9 , Title10 , Title11 , Title12 , Title13 , Title14 , Title15 , Title16 , Title17 , Title18 , Title19 , Title20 , Title21 , Title22 , Title23 , Title24 , Title25 , Title26 , Title27 , Title28 , Title29 , Title30 , Title31 , Title32 , Title33 , Title34 , Title35 , Title36 , Title37 , Title38 , Title39 , Title40 , Title41 , Title42 , Title43 , Title44 , Title45 , Title46 , Title47 , Title48 , Title49 , Title50 , Title51 , Title52 , Title53 , Title54 , Title55 , Title56 , Title57 , Title58 , Title59 , Title60 , Title61 , Title62 , Title63 , Title64 , Title65 , Title66 , Title67 , Title68 , Title69 , Title70 , Title71 , Title72 , Title73 , Title74 , Title75 , Title76 , Title77 , Title78 , Title79 , Title80 , Title81 , Title82 , Title83 , Title84 , Title85 , Title86 , Title87 , Title88 , Title89 , Title90 , Title91 , Title92 , Title93 , Title94 , Title95 , Title96 , Title97 , Title98 , Title99 , Title100 , Title101 , Title102 , Title103 , Title104 , Title105 , Title106 , Title107 , Title108 , Title109 , Title110 , Title111 , Title112 , Title113 , Title114 , Title115
Deadline
23 Dec 2025
View Details

Frequently Asked Questions

Key insights about Niger tender market

How many niger tenders are available?

There are 0 active niger tenders across India from various government departments and PSUs.

Who are the major buyers?

Leading organizations include Indian Council Of Agricultural Research (icar), Central University Of Haryana, Homoeopathy Directorate Government Of Uttar Pradesh. These buyers regularly publish tenders for various requirements.

What is the EMD requirement?

EMD varies from ₹2K to ₹10.1 lakh. Average EMD is ₹2.0 lakh, depending on tender value.

How to participate in these tenders?

Register on e-procurement portals, ensure GST and required certifications are valid, review documents carefully, and submit bids before deadline with EMD.

Tips for winning government tenders?

Focus on competitive pricing, technical compliance, relevant experience, timely submission, complete documentation, and understanding buyer requirements.

Ready to Explore Niger Opportunities?

Join thousands of businesses discovering high-value government procurement opportunities.