904 Nainital Tenders in Uttarakhand - Government Procurement

Camera for CCTV System (V3) (Q2) , Video Recorder for CCTV System (V2) (Q2) , Television (TV) (V2) (Q2) , Networking / Server Rack (Q2) , Layer 2 Access Switch (V2) (Q2)

Jaadui Pitara (NCERT) (Q3)

VM FEED

LIME QUICK

Nfion Dryer

Custom DNA Synthesis of Primers 25 nmol , Prime Script 1st strand cDNA Synthesis Kit 50 reactions , TB Green Pre Mix Ex Taq II Tli RNAse H Plus , RNAiso plus Total RNA extraction reagent , Amylase from Bacillus licheniforms , Amyloglucosidase from Aspergillus niger lyophilized Powder 70 U mg , Glucose Oxidase form Aspergillus niger type VII lyophilized powder 100000 units g solid without added oxygen , Peroxidase from horseradish type II essentially salt free lyophilized powder 150 250 units mg solid using pyrogallol , Primers Forward Revers Total Base 1249 , Fish Immunoglobulin M Ig ELISA kit 96T , Superoxide Dismutase SOD ELISA kit , Fish lysozyme renal amyloidosis LZM ELISA kit , Fish Interleukin 6 IL 6 ELISA Kit , Fish Cortisol ELISA Kit , Forward Primers , Reverse Primer , Taq DNA Polymerase , EZAssay Antioxidant activity estimation kit CUPRAC 200 tests , Azo M Protein Azo Casein , EZdetect PCR kit for Mycoplasma detection Based on 16S 23S rRNA spacer region , Trypsin inhibitor powder source Soyabean Cell culture tested Activity 7000BAEE units of inhibition mg , COIF1 5TCAACCAACCACAAGACATTGGCAC3 26 nucleotides , COIR1 5TAGACTTCTGGGTGCCAAAGAATCA3 26 nucleotides , M151 5AACCCGGCTTTCGGCAGCA3 20 nucleotides , M152 5CGGGGCGGGGTTGTGAGAT3 20 nucleotides , IHN UP F 5AGAGATCCCTACACCAGAGAC 3 21 nucleotides , IHN UP R 5AGAGATCCCTACACAGAGAC 3 21 nucleotides , VN F 5ATGGAAGGAGGAATCGTGAAGCG 3 24 nucleotides , VN R 5 GCGGTGAAGTGCTCAGTTCCC 3 22 nucleotides , IPN F 5 GTGCTGGCCACAACGACAAC 3 21 nucleotides , IPN R 5 AATTGGTCTGCCGTTCCTA 3 19 nucleotides , ISAoic F 5 GGCTATCTACCAT AACGAAT 3 21 nucleotides , ISAoic R 5 GCCAAGTGTAAGTGCACTCC 3 21 nucleotides , Bench Top 1kb DNA Ladder , Bench Top 100bp DNA Ladder , Bench Top PCR Marker , Taq DNA Polymerase recombinant 5U uL , Quick CIP 1000 units with buffer , T4 DNA Ligase 20000 units , ProtoScript II First Strand cDNA Synthesis Kit 30 reactions , Q5 High Fidelity 2X Master Mix 100 reactions , OneTaq 2X Master Mix with Standard Buffer 100 reactions , Synthetic peptides , SpectraDrop 24 Kit , Easy Yeast Plasmid Isolation Kit 50 rxns , Quick Easy Yeast Transformation Mix 20rxn , Western BLoT Immuno Booster PF 250ml , Western BLoT Blocking Buffer Protein Free 500ml , FastDigest ApaI 300rxn , FastDigest BamHI 800rxn , FastDigest BgIII 100rxn , FastDigest EcoRI 800rxn , FastDigest EcoRV Eco32I 200 rxn , FastDigest HindIII 800rxn , FastDigest KpnI 300rxn , FastDigest NcoI 20rxn , FastDigest Ndel 100 rxn , FastDigest Nhel 50 rxn , FastDigest Notl 50 rxn , FastDigest SaII 200rxn , FastDigest SmaI 100 rxn , FastDigest SacI 100 rxn , FastDigest XbaI 300 rxn , FastDigest XhoI 400 rxn , FastDigest value pack , Synthetic peptide , MRGSH 011FW , MRGSH 011RV , SHRV 1 F , SHRV 1 R , SHRV 2 F , SHRV 2 R , SHRV IPC2 fwd , SHRV IPC2 rev , Bacterial Genome Sequencing

Fully Automated Immunohematology Analyzer (Q2)

Microdebrider with Micro Drill

Rainbow trout Larval Feed 0 point 3 mm pallet , Rainbow trout Larval Feed 0 point 5 mm pallet , Rainbow trout Larval Feed 0 point 8 mm pallet , Rainbow trout nursery Feed 1 point 2 mm floating pallet , Rainbow trout grower Feed 1 point 8 mm floating pallet , Rainbow trout grower Feed 3 mm floating pallet , Rainbow trout grower Feed 6 mm floating pallet , Rainbow trout nursery Feed 0 point 8 mm pallet , Rainbow trout early grower Feed 1 point 2 mm floating pallet , Rainbow trout early grower Feed 1 point 8 mm floating pallet , Carp Feed 4 mm floating , plastic insulated ice box , Oxygen cylinder , Weighing balance , Drag net , Hand net , Hapa , Polythene bag , Silpoline , Fish Wader