Custom DNA Synthesis of Primers 25 nmol,Prime Script 1st strand cDNA Synthesis Kit 50 reactions,TB

Tender Overview

Additional Information

Custom DNA Synthesis of Primers 25 nmol,Prime Script 1st strand cDNA Synthesis Kit 50 reactions,TB

Item Category

Custom DNA Synthesis of Primers 25 nmol , Prime Script 1st strand cDNA Synthesis Kit 50 reactions , TB Green Pre Mix Ex Taq II Tli RNAse H Plus , RNAiso plus Total RNA extraction reagent , Amylase from Bacillus licheniforms , Amyloglucosidase from Aspergillus niger lyophilized Powder 70 U mg , Glucose Oxidase form Aspergillus niger type VII lyophilized powder 100000 units g solid without added oxygen , Peroxidase from horseradish type II essentially salt free lyophilized powder 150 250 units mg solid using pyrogallol , Primers Forward Revers Total Base 1249 , Fish Immunoglobulin M Ig ELISA kit 96T , Superoxide Dismutase SOD ELISA kit , Fish lysozyme renal amyloidosis LZM ELISA kit , Fish Interleukin 6 IL 6 ELISA Kit , Fish Cortisol ELISA Kit , Forward Primers , Reverse Primer , Taq DNA Polymerase , EZAssay Antioxidant activity estimation kit CUPRAC 200 tests , Azo M Protein Azo Casein , EZdetect PCR kit for Mycoplasma detection Based on 16S 23S rRNA spacer region , Trypsin inhibitor powder source Soyabean Cell culture tested Activity 7000BAEE units of inhibition mg , COIF1 5TCAACCAACCACAAGACATTGGCAC3 26 nucleotides , COIR1 5TAGACTTCTGGGTGCCAAAGAATCA3 26 nucleotides , M151 5AACCCGGCTTTCGGCAGCA3 20 nucleotides , M152 5CGGGGCGGGGTTGTGAGAT3 20 nucleotides , IHN UP F 5AGAGATCCCTACACCAGAGAC 3 21 nucleotides , IHN UP R 5AGAGATCCCTACACAGAGAC 3 21 nucleotides , VN F 5ATGGAAGGAGGAATCGTGAAGCG 3 24 nucleotides , VN R 5 GCGGTGAAGTGCTCAGTTCCC 3 22 nucleotides , IPN F 5 GTGCTGGCCACAACGACAAC 3 21 nucleotides , IPN R 5 AATTGGTCTGCCGTTCCTA 3 19 nucleotides , ISAoic F 5 GGCTATCTACCAT AACGAAT 3 21 nucleotides , ISAoic R 5 GCCAAGTGTAAGTGCACTCC 3 21 nucleotides , Bench Top 1kb DNA Ladder , Bench Top 100bp DNA Ladder , Bench Top PCR Marker , Taq DNA Polymerase recombinant 5U uL , Quick CIP 1000 units with buffer , T4 DNA Ligase 20000 units , ProtoScript II First Strand cDNA Synthesis Kit 30 reactions , Q5 High Fidelity 2X Master Mix 100 reactions , OneTaq 2X Master Mix with Standard Buffer 100 reactions , Synthetic peptides , SpectraDrop 24 Kit , Easy Yeast Plasmid Isolation Kit 50 rxns , Quick Easy Yeast Transformation Mix 20rxn , Western BLoT Immuno Booster PF 250ml , Western BLoT Blocking Buffer Protein Free 500ml , FastDigest ApaI 300rxn , FastDigest BamHI 800rxn , FastDigest BgIII 100rxn , FastDigest EcoRI 800rxn , FastDigest EcoRV Eco32I 200 rxn , FastDigest HindIII 800rxn , FastDigest KpnI 300rxn , FastDigest NcoI 20rxn , FastDigest Ndel 100 rxn , FastDigest Nhel 50 rxn , FastDigest Notl 50 rxn , FastDigest SaII 200rxn , FastDigest SmaI 100 rxn , FastDigest SacI 100 rxn , FastDigest XbaI 300 rxn , FastDigest XhoI 400 rxn , FastDigest value pack , Synthetic peptide , MRGSH 011FW , MRGSH 011RV , SHRV 1 F , SHRV 1 R , SHRV 2 F , SHRV 2 R , SHRV IPC2 fwd , SHRV IPC2 rev , Bacterial Genome Sequencing

Organization Details

Documents & Downloads