TenderDekho Logo
Bottled Agar Media city-wide in Kangra

Bottled Agar Media Tenders in Kangra

Access live Bottled Agar Media procurement tenders in Kangra. Major buyers include Central University Of Himachal Pradesh and Dg Armed Forces Medical Service. Combined opportunity value of ₹137

Location
Major Buyer
0

Petroleum ether 4L,Boric Acid 1000 g,Sodium Chloride 1000 g,Perchloric acid 70 percent 500 ml,Nitri

Central University Of Himachal Pradesh

KANGRA, HIMACHAL PRADESHPosted 29 Jan
GEMGoods3 Documents
Category: Petroleum ether 4L , Boric Acid 1000 g , Sodium Chloride 1000 g , Perchloric acid 70 percent 500 ml , Nitric acid 500 ml , n hexane 1500 ml , HCl 37 percent 1500 ml , Methanol 7000 ml , Potassium hydroxide pellets 200 g , Sodium sulphate anhydrous 1L , Ethanol Absolute 99 point 9 percent 40 L , Phosphate buffer saline 1000 ml , Standard Vitamins A or Retinyl palmitate 200 mg , Trichloroacetic acid 500 mg , Absolute alcohol 1000 ml , 2 2 dipyridyl 200 g , Ferric chloride or F2eCl36H20 200 g , Sodium bicarbonate 500 g , Oxalic acid 4 percent 500 ml , Xylene 1 L , 2 6 Dichlorophenol indophenol 500 g , Sulphuric acid 2 L , Thiourea 100 g , Bromine water 500 ml , Vitamin C or Ascorbic acid standard 10 g , Vitamin D standard D2 Ergocalciferol 5 g , Vitamin D standard D3 Cholecaliferol 10 g , 2 propanol 200 ml , Potassium ferricyanide 250 g , Standard thiamine Hydrochloride 200 g , Isobutyl alcohol 300 ml , Riboflavin standard 100 g , P2O5 50 g , Sodium hydrosulphite 50 g , Papain 200 g , Sodium acetate buffer 7 500 ml , Standard tryptophan 200 g , Chloroform 2500 ml , High capacity cDNA reverse transcription kit Cdna kit 50 reactions , DPX 500 ml , TRIS 500 g , Urea 500 g , Red Congo agar 500 g , Tryptic soy agar 500 g , MRS agar 500 g , Nutrient agar 500 g , Casein hydrolysis agar 500 g , Christensens urea agar 500 g , Starch hydrolysis agar 500 g , Tryptophan peptone broth 500 g , MRS broth 500 g , Phenol red carbohydrate broth 500 g , Nutrient broth 500 g , Motility test medium 500 g , Nitrite and nitrate reduction media 500 g each , Tryptic soy broth 500 g , Pepsin, tryptophan and cysteine 50 g each , Kovacs oxidase reagent 20 ml , Kovacs indole reagent 100 ml , Hydrogen peroxide 30 percent 500 ml , Phenol red powder 25 g , Potassium hydroxide 500 g , Rnase 20 ml , Proteinase k 20 ml , Amoxiclav 1 vial of 100 discs , Amoxycillin 1 vial of 100 discs , Streptomycin 1 vial of 100 discs , Erythromycin 1 vial of 100 discs , Vancomycin 1 vial of 100 discs , Tetracycline 1 vial of 100 discs , Chloramphenicol 1 vial of 100 discs , Clindamycin 1 vial of 100 discs , Oxacillin 1 vial of 100 discs , Cephalothin 1 vial of 100 discs , Penicillin G 1 vial of 100 discs , Beef extract powder 500 g , Molecular primer Forward primer GM3 5AGAGTTTGATCMTGGC 3 and Reverse Primer GM4 5TACCTTGTTACGACTT3
Deadline
24 Feb 2025
View Details

Aluminium Foil 1kg,Beaker 1000ml,Beaker 100ml,Beaker 10ml,Beaker 250ml,Beaker 50 ml,Beaker 500ml,Br

Central University Of Himachal Pradesh

KANGRA, HIMACHAL PRADESHPosted 3 Mar
GEMGoods3 Documents
Category: Aluminium Foil 1kg , Beaker 1000ml , Beaker 100ml , Beaker 10ml , Beaker 250ml , Beaker 50 ml , Beaker 500ml , Brushes for glassware Cleaning Small and Large , Centrifuge Tube Plastic 50ml 500 Per Pack , China dish 4 inches , Conical Flask B 24 100 ml , Conical Flask B 24 50 ml , Copper Water Bath 1 Litre , Crucible with lid 30 ml , Dialysis Membrane 70 one Meter 12KDA to 14KDA , Funnel 75mm 12 Per Pack , Gas Pipe Line Rubber Tubing 10 meter , Glass Capillary tube 100 Per pack For Tlc , Glass Condenser B 24 or B 29 , Glass Dropper graduated 10 mm , Glass Petri Dish 100x17mm , Glass Stalagonometer , Glass Test tube Graduated 15 ml , Glass Weighing Scoop 10ml , Glass Weighing Scoop 6ml , Graduated Pipette 10ml , Magnetic Beads 12x6mm , Magnetic Beads 20x8mm , Measuring Cylinder 10ml , Micro Spatula Stainless steel 8 inch , Micro Tips 100 to 1000 microlitre 1000 Per Pack , Micro Tips 10 to 100 microlitre 1000 Per Pack , Museum jar S line 210x170x130mm Glass chamber , Pastic Beaker 1000 ml , PH Paper , Pipette 10 ml Graduated , Reagent Bottle with Screw cap 100ml , Separating funnel ISO shape 500 ml , Separating funnel ISO Shape 250 ml , Slides Micro scopic 50 Per pack 76x26 , Stirring Rod 9x255 , Test tube Stand Plastic 20mm dia and 20 holes 4 Per Pack , Tissue Roll , Utility Tray 375x300x75mm , UV Cuvette Pair quartz Spectrophotometer , Volumetric flask 250 ml , Filter Paper sheet odinary 500 Per pack , Whatman Filter Paper Number 1 125mm 100 PerPack , Wire Gauge 150x150 , Aluminium TLC Plate
Deadline
24 Mar 2025
View Details

Measuring Cylinder 5 ml,Measuring Cylinder 10 ml,Measuring Cylinder 25 ml,Measuring Cylinder 1000 m

Central University Of Himachal Pradesh

KANGRA, HIMACHAL PRADESHPosted 5 Mar
GEMGoods3 Documents
Category: Measuring Cylinder 5 ml , Measuring Cylinder 10 ml , Measuring Cylinder 25 ml , Measuring Cylinder 1000 ml , Conical flask with screw cap 1000 ml , Conical flask with screw cap 250 ml , Beaker 2000 ml , Beaker 500 ml , Beaker 250 ml , Beaker 100 ml , Beaker 50 ml , Reagent bottles 500 ml , Reagent bottles 1000 ml , Filter Flask with socket and Buchner funnel with sintered disk Flask cap 500ml and Buchner Funnel 200ml , Micro-centrifuge tubes 2 ml , Amber color culture tubes with screw cap 50 ml , Petri dish 60mm , Petri dish 100 mm , Petri dish 150 mm , Micropipette 0.2-2.0 ul , Micropipette 2-20 ul , Micropipette 20-200 micro liter , Micropipette 100-1000 ul , Mortar and pestle 100-200 ml , Droppers 10 ml , Tissue paper high quality , Filter paper A Grade , Alumina Crucible 1400 C 50 ml , silica crucibles 50 ml , Quickpip Multichannel Pipette 5 to 50 ul , Micropipette stand having capacity 6 , tray polypropylene 375 x350 x 130 mm , tray polypropylene 540x 435x 130 mm , tray polypropylene 220 x 150x 70 mm , Petri dish disposable, polypropylene free size , Aspirator bottles, polypropylene 10 , Aspirator bottles, polypropylene 20 , Magnetic beads 15x8 , Magnetic beads 25 X8 , HAEMOCYTOMETER COMPLETE SET , Test Tube Stand 24 holes , Corning multiwell plates, plate lids and sealing mats 04 set
Deadline
27 Mar 2025
View Details

Potassium hydroxide 1000 g,4 percent Paraformaldehyde 500 ml,Phenol chloroform isoamyl alcohol 300

Central University Of Himachal Pradesh

KANGRA, HIMACHAL PRADESHPosted 26 Mar
GEMGoods3 Documents
Category: Potassium hydroxide 1000 g , 4 percent Paraformaldehyde 500 ml , Phenol chloroform isoamyl alcohol 300 ml , Sodium carbonate 500 g , Thiobarbituric acid 125 g , Sodium hydroxide 1000 g , Superoxide Dismutase antioxidant assay kit calorimetric 1 , Riboflavin 100 g , Trypan Blue zero point four percent Solution 50 ml , Guaiacol 250 g , Iron chloride FeCl3 100 g , Potassium Ferricyanide 100 g , Iodine 100 g , Dichloromethane 100 ml , Iron sulfate FeSO4 500 g , Sodium Hypochlorite NaOCl 500 ml , Perchloric Acid HClO4 500 ml , Zinc Chloride ZnCl2 500 g , Sodium Iodide NaI 500 g , Phosphate Buffer 500 ml , DNA Extraction Kit for Animal tissue 2 , PCR kit 2 , PBS Phosphate buffered saline 1000 ml , Sodium Chloride 1000 g , Bouins fixative 500 ml , Bradford reagent 1000 ml , ALT Activity kit Calorimetric 50 rxn , AST Activity kit Calorimetric 50 rxn , ALP Activity kit Calorimetric 50 rxn , Giemsa stain 50 ml , Ethanol 15 L , Nitroblue tetrazolium NBT 25 g , S Acetylthiocholine iodide 25 g , Potassium cyanide 500 g , Drabkins reagent 500 ml , Hayemis RBC diluting fluid 100 ml , Turks WBC diluting fluid 100 ml , Heparin anticoagulant 50 ml , Hydrogen peroxide 1500 ml , 1 Chloro2 4 Dinitrobenzene CDNB AR 100 g , Glutathione Reduced GSH 25 g , Two point five percent Glutaraldehyde 500 ml , Diethyl ether AR 1000 ml , Petroleum ether AR grade 2500 ml , Pyrogallol 100 g , Nitric acid 1000 ml , Perchloric acid 1000 ml , Glacial acetic acid 1500 ml , L tryptophan extrapure 100 mg , Barium chloride dehydrate 500 g , Gum acacia 500 g , Magnesium chloride hexahydrate 500 g , Potassium nitrate 500 g , Methyl cellosolve 1000 ml , Citric acid 500 g , Sodium citrate tribasic dehydrate extrapure 98 percent 500 g , Anthrone ACS 98 percent 25 g , N propanol 1000 ml , Ammonium metavanadate 100 g , Phenol crystalline extrapure AR 500 g , Boric acid 500 g , Papain 100 g , Ferric chloride hexahydrate A 100 g , Starch 1000 g , Donepezil hydrochloride 1 , Master mix PCR 100 rxn , DPPH 2 g , ATBS 5 g , CTAB 3 kit , Mcnkey broth 500 g , MHA muller hinton broth 500 g , Sterile disc 2 pack , Plate count agar 500 g , M17 agar 500 g , M17 broth 500 g , Ox bile Ox gall 500 g , MHA agar 500 g , MRS broth 1000 g , MRS agar 1000 g , Pepsin and cysteine 25 g each , X gal 5 bromo 4 chloro 3 indolyl beta D galactopyranoside 1 g , 10 micro leter IPTG iso propylthio beta D galactopyranoside 5 g , Columbia agar 500 g , DNA extraction kit for bacteria 1 pack , Molecular primer 27F 5AGAGTTTGATCCTGGCTCAG 3 and 1492R 5 TACGGTACCTTGTTACGACTT3 , Wurster reagent N N N N tetramethyl pphenylenediamine 10 g , Sucrose lactose maltose glucose fructose xylose sorbitol 500 g each , D Arabinose 100 g , D Reffinose 100 g , Gram staining kit 200 ml reagents , Trypsin 10 g , Nutrient Agar 500 g , Nutrient Broth 500 g
Deadline
16 Apr 2025
View Details

Dg Armed Forces Medical Service Tender for Dry View Fuji/ Konica Film & Medical Supplies in Kangra Himachal Pradesh 2025

Dg Armed Forces Medical Service

KANGRA, HIMACHAL PRADESHPosted 9 Nov
₹10.5 L
EMD: ₹137
GEMGoods3 Documents
Category: Dry View Fuji film For CR Machine 12 x 10 , Dry View Konica film for CR Machine SD E 12 x 10 , Suction catheter FR 6 , Suction Catheter FR 8 , Suction Catheter FR 10 , Suction Catheter FR 12 , Suction Catheter FR 14 , Syp paracetamol 250 mg , Syp Dextromethorphan Hydrobromide and Chlorpheniramine Maleate Bott 60 ml , Clearwax ear drops , Betamethasone cream , AMBU BAG 500 ml , Infant BP cuff manual , Paediatric BP Cuff Manual , Tegaderm Dressing small , Intraosseus needle Paediatric , Disposable Spo2 Probes Nellcor , Yankur Suctor connector , Central line triple lumen size 3F , Central line triple lumen size 4F , Central line triple lumen size 5F , HME Filter , MMR vaccine single dose 0 PT 5ml , Pneumococcal Polysaccharide Vaccine PPSV 23 , Hepatitis A vaccine , H 360 Erba Diluent , H 360 Erba lyser , E lite H Clean Erba , PCI Lyte elctrolyte Reagent , Wire Loop Nychrome , Nepafenac micronized suspension 0 PT 1 with Stablized Oxychloro complex , Lutein 5 mg PLUSZeaxanthin 1 mg PLUSOmeza 3 fatty acids 500mg , Triamcinolone 40mg SLASH ml Preservative Free Inj for Intravitreal Use , HPMC 0 PT 3 Dextran 70 0 PT 1 Glycerin 0 PT 2 Sodium Perborate 0 PT 28mg , Voriconazole Eye Drops , Besifloxacin ophthalmic suspension 0 PT 6 , Tobramycin and Flurometholone eye drops , Gatifloxacin 0 PT 3 PLUSDexamethasone 1 Vial Of 5ml Eye Drops , Hyaluronidase 1500 IU Inj , Hydroxy Propyl Methyl Cellulose 2 Eye Oint , Moxifloxacin 0 PT 50 Oint , Needle Disposable 26 G , Needle Disposable 30 G , Rose Bengal Dye , Sterile Irrigating Balanced Salt Soln BSS For Ophthalmic Surgery Bott Of 500 ml , Sterile Eye patch with adhesive Disposable , Multipiece hydrophobic acrylic IOLwith blue PMMA haptics RI not less than 1 PT 50 , Inj Sodium Hyaluronate 30 mg SLASH ml with Sodium Chondroitin sulphate 40 mg SLASH ml , 2 PT 3 sodium Hyaluronate 0 PT 60 ml Average molecular weight 32 00 999 Daltons , Mini monaka stent , silicon lacrimal punctal plugs , Inj Tropicamide PLUS Phenylephrine Hydrochloride PLUSLidocain , Ripasudil 0 PT 4 eye drop bottle of 5 ml , Netarsudil 0 PT 02 eye drop bottle of 3 ml , FMS Packs for ALCON LAUREATE Phaco Machine , D Dimer 1X20 test , HbA1C 1X20 test , Quantative CRP 1X20 test , Dengue kit 1X10 test , Typhi Dot 1X50 test , Bovine Albumin , Petri Dish for culture AND sensitivity , Readymade Leishmen Stain , tab pentoxyphyline 400mg , tab thiamine100 mh , influenza vaccine , orosore gel , INJ NEUROBION , adult diaper Medium , adult diaper Large , adult diaper xl , adult diaper xxl , band aid , typhoid polysaccharide vaccine , tab linagliptin 5mg , cap itraconazone 100mg , Syp n cold , Syp tixilix , prolene no 1 loop round body , laproscopic drape
Deadline
15 Dec 2025
View Details

Dg Armed Forces Medical Service Widal Test Kit and Reagents Tender Kangra Himachal Pradesh 2025

Dg Armed Forces Medical Service

KANGRA, HIMACHAL PRADESHPosted 15 Dec
₹14.1 L
GEMGoods3 Documents
Category: Widal Test Kit , CRP Quantative 1 20 test , HbA1c Tulip Turbodyne 1x , DspaceDimer 1x20 Test T , EspaceCheck Quality , RA Factor Qualitative , PC Lyte Electrolyte Reagent , Sterile Urine Container , Kit for Estimation of Ckspa , Dengue J Mitra NS1Ag and I , Prothrombine Time Reagent , Cell Pack XPspace100 , Stromatolyser XPspace100 , Readymade Leishman St , Muller Hinton Agar MHA , Slide Microscopic Thickne , Micro Cover Glasses 22x50 , VDRL Rapid Test Kit pack of , Wire Loop for Culture , Strips Albumin and Glucose , Swab Stick , PTTK Test Kit with Cacl2 , Cell Clean Sysmax , Multi Stick 10SG pkt of 100 Urosticks Siemens , Blood Sedimentation Rate P , Elisa Reader Thermal Paper , Pci Lyte Print Paper Roll , Pci Lyte Pump Tube , Pci Lyte Deproteinizer , Pci Lyte Cleaning Sol , Pci Lyte Activating Sol Electrolyte Analyser , Gram Stain Kit , ZN Stain Kit , CRP Qualitative , Serum Anti A1 , Anti D IgG and IgM , Serum Anti H 1x5 ml , Serum Anti Human Globulin , Bovine Serum Albumi , Anti D IgG Bott of 10 ml , Anti D IgM Bott of 10 ml , Formaldehide 40percent , Abs Alcohol Dehydrate , Acetone Commersial , Parafin Wax , Acid Sulfuric Commersial , Rapid PAP Stain , Xylene , Readymade Hemotoxyline Stain , Blood Agar Base , Cled Agar with Indic , Sugar Set Readymade for , Sabouraud Dextrose Agar , KOH 40percent , KOH 20percent , Settle Plate , Rodac Plate , LPCB , Gentamycin 10 mcg ABST , Netilmicin 30 mcg ABS , Levofloxacin 5 mcg ABS , Ciprofloxacin 5 mcg A , Trimethoprim 1 25slas , Naldixic Acid 30 mcg ABST , PipracilinslashTazobact , Cefotaxime 30 mcg ABST , Meropenem 10 mcg AB , Norfolaxacin 10 mcg ABST , Clindamycin 2 mcg ABST , Amikacin 30 mcg ABST , Vancomycin 30 mcg ABS , Linezolid 30 mcg ABST Di , Ofloxacin 5 mcg ABST Disc , Imipenem 10 mcg ABST Di , Tobramycin 10 mcg ABST , Ampicillin 10 mcg A , Nitrofurantoin 300 , Ceftazidime 30 mcg ABST , Amoxyclav 30 mcg A , Ceftriaxone 30 mcg , Cefixime 5 mcg ABST Disc , CefoperazoneslashSulbact , Amoxycillin 30 mcg ABST , CSF Microprotein Detection , CSF Globulin Detection Kit , Feather Microtome Blade
Deadline
29 Dec 2025
View Details

MRS agar,MRS broth,Proteinase K,Rnase,Isopropanol,Amoxycillin,Chloramphenicol,Tetracycline,Erythrom

Central University Of Himachal Pradesh

KANGRA, HIMACHAL PRADESHPosted 13 Jan
₹4.8 L
GEMGoods4 Documents
Category: MRS agar , MRS broth , Proteinase K , Rnase , Isopropanol , Amoxycillin , Chloramphenicol , Tetracycline , Erythromycin , Master mix , Phenol chloroform isoamyl alcohol , n- Hexadecane , Resazurin dye , Sucrose and Lactose , Molecular primer , Skimmed milk agar , Litmus Skim milk broth , 2 2 azino bis 3 ethylbenzothiazoline 6 sulfonic acid ABTS , Spirit , Ethanol , Tetrahydrofuran , Mineral Salt agar , Minimal Broth w o Dextrose , Oxidase discs , Urease discs , Nitrate reagent Discs Twin pack , HiIMViC Biochemical test kit , Alamar Blue Reagent , Solasodine, C27H43NO2 95percent Purity HPLC grade , solanine C45H73NO15 95percent Purity HPLC grade , Vitexin C21H20O10 95percent Purity HPLC grade , Luteolin C15H10O6 95percent Purity HPLC grade , Benzaldehyde , N amyl acetate , 2 7 dichlorofluoroescein , Glycerol , Polyvinyl chloride , 2 3 5 triphenyltetrazolium chloride , Acetic acid , Antimony trichloride , Ethyl acetate , Sodium iodide , Sodium hydroxide , Potassium hydroxide , Ferric alpha alpha dipyridyl reagent , HPLC grade Ethanol 100 percent , Dulbeccos Modified Eagle Medium DMEM High Glucose , Dulbeccos Modified Eagle Medium DMEM Low Glucose , RPMI , DMSO Dimethyl Sulfoxide , Fetal Bovine Serum FBS , Trypsin , DCFH DA 2 7 Dichlorofluorescein diacetate , Methanol , Phosphate Buffered Saline PBS , Penicillin Powdered form , Streptomycin Powdered form , Vancomycin Powdered form , Tetracycline Powdered form , Azithromycin Powdered form , Clindamycin Powdered form , High capacity cDNA reverse transcriptase kit 50 reaction , RNA Isolation Kit 50 rxn , MTT powder , MH agar , MH broth , Nutrient broth , Nutrient agar media , TRIzol , Myrcene , Putrescine , Trimethylamine , Ethyl Butyrate , Limonene , CMC Agar Salt , Bacteria g DNA Isolation Kit Purification Genomic , Xylan , Lignin
Deadline
3 Feb 2026
View Details

Aluminium Foil Thick Sheet Lab Purpose 1kg,Beaker Glass 1000 ml,Beaker Glass100 ml,Beaker Glass 10

Central University Of Himachal Pradesh

KANGRA, HIMACHAL PRADESHPosted 15 Jan
₹5.0 L
GEMGoods3 Documents
Category: Aluminium Foil Thick Sheet Lab Purpose 1kg , Beaker Glass 1000 ml , Beaker Glass100 ml , Beaker Glass 10 ml , Beaker Glass 250 ml , Beaker Glass 50 ml , Beaker Glass 500 ml , Brushes for glassware Cleaning Small and Large , Centrifuge Tube Plastic 50 ml 500 Per Pack , China dish 4 inches , Conical Flask B 24 100 ml , Conical Flask B 24 50 ml , Copper Water Bath 1 Litre , Crucible with lid 30 ml , Dialysis Membrane 70 one Meter 12KDA to 14KDA , Funnel 75mm 12 Per Pack , Gas Pipe Line Rubber Tubing 10 meter , Glass Capillary tube 100 Per pack For TLC , Glass Condenser B 24 or B 29 , Glass Dropper graduated 10 ml , Glass Petri Dish 100x17mm , Glass Stalagonometer , Glass Test tube Graduated 15 ml , Glass Weighing Scoop 10 ml , Glass Weighing Scoop 6 ml , Graduated Pipette 10 ml , Magnetic Beads 12x6 mm , Magnetic Beads 20x8 mm , Measuring Cylinder 10 ml , Micro Spatula Stainless steel 8 inch , Micro Tips 100 to 1000 microlitre 1000 Per Pack , Micro Tips 10 to 100 microlitre 1000 Per Pack , Museum jar S line 210x170x130mm Glass chamber , Pastic Beaker 1000 ml , PH Paper , Pipette 10 ml Graduated , Reagent Bottle with Screw cap 100 ml , Separating funnel ISO shape 500 ml , Separating funnel ISO Shape 250 ml , Slides Micro scopic 50 Per pack 76x26 , Stirring Rod 9x255 , Test tube Stand Plastic 20mm dia and 20 holes 4 Per Pack , Tissue Roll , Utility Tray 375x300x75 mm , UV Cuvette Pair quartz Spectrophotometer , Volumetric flask 250 ml , Filter Paper sheet ordinary 500 Per pack , Whatman Filter Paper Number 1 125mm 100 PerPack , Wire Gauge 150x150 mm , Aluminium TLC Plate
Deadline
5 Feb 2026
View Details