Bottled Agar Media city-wide in Kangra

Bottled Agar Media Tenders in Kangra

Explore city-wide bottled agar media procurement opportunities in Kangra. Major buyers include Central University Of Himachal Pradesh and Dg Armed Forces Medical Service. Tender values range from ₹10.5 Lakh to ₹14.1 Lakh. EMD up to ₹0K. Procurement sources: Gem (4). Track active bids, eligibility criteria, and deadlines for this city.

Live Opportunities

National Reach

0 tenders

Oxalic acid graterthan 99point5 percent CAS 6153-56-6,2 4 Dinitrophenol 99 percent CAS 51-28-5 3x10

Central University Of Himachal Pradesh

KANGRA, HIMACHAL PRADESHPosted 22 Mar

GEMGoods3 Documents

Potassium hydroxide 1000 g,4 percent Paraformaldehyde 500 ml,Phenol chloroform isoamyl alcohol 300

Central University Of Himachal Pradesh

KANGRA, HIMACHAL PRADESHPosted 26 Mar

GEMGoods3 Documents

Category: Potassium hydroxide 1000 g , 4 percent Paraformaldehyde 500 ml , Phenol chloroform isoamyl alcohol 300 ml , Sodium carbonate 500 g , Thiobarbituric acid 125 g , Sodium hydroxide 1000 g , Superoxide Dismutase antioxidant assay kit calorimetric 1 , Riboflavin 100 g , Trypan Blue zero point four percent Solution 50 ml , Guaiacol 250 g , Iron chloride FeCl3 100 g , Potassium Ferricyanide 100 g , Iodine 100 g , Dichloromethane 100 ml , Iron sulfate FeSO4 500 g , Sodium Hypochlorite NaOCl 500 ml , Perchloric Acid HClO4 500 ml , Zinc Chloride ZnCl2 500 g , Sodium Iodide NaI 500 g , Phosphate Buffer 500 ml , DNA Extraction Kit for Animal tissue 2 , PCR kit 2 , PBS Phosphate buffered saline 1000 ml , Sodium Chloride 1000 g , Bouins fixative 500 ml , Bradford reagent 1000 ml , ALT Activity kit Calorimetric 50 rxn , AST Activity kit Calorimetric 50 rxn , ALP Activity kit Calorimetric 50 rxn , Giemsa stain 50 ml , Ethanol 15 L , Nitroblue tetrazolium NBT 25 g , S Acetylthiocholine iodide 25 g , Potassium cyanide 500 g , Drabkins reagent 500 ml , Hayemis RBC diluting fluid 100 ml , Turks WBC diluting fluid 100 ml , Heparin anticoagulant 50 ml , Hydrogen peroxide 1500 ml , 1 Chloro2 4 Dinitrobenzene CDNB AR 100 g , Glutathione Reduced GSH 25 g , Two point five percent Glutaraldehyde 500 ml , Diethyl ether AR 1000 ml , Petroleum ether AR grade 2500 ml , Pyrogallol 100 g , Nitric acid 1000 ml , Perchloric acid 1000 ml , Glacial acetic acid 1500 ml , L tryptophan extrapure 100 mg , Barium chloride dehydrate 500 g , Gum acacia 500 g , Magnesium chloride hexahydrate 500 g , Potassium nitrate 500 g , Methyl cellosolve 1000 ml , Citric acid 500 g , Sodium citrate tribasic dehydrate extrapure 98 percent 500 g , Anthrone ACS 98 percent 25 g , N propanol 1000 ml , Ammonium metavanadate 100 g , Phenol crystalline extrapure AR 500 g , Boric acid 500 g , Papain 100 g , Ferric chloride hexahydrate A 100 g , Starch 1000 g , Donepezil hydrochloride 1 , Master mix PCR 100 rxn , DPPH 2 g , ATBS 5 g , CTAB 3 kit , Mcnkey broth 500 g , MHA muller hinton broth 500 g , Sterile disc 2 pack , Plate count agar 500 g , M17 agar 500 g , M17 broth 500 g , Ox bile Ox gall 500 g , MHA agar 500 g , MRS broth 1000 g , MRS agar 1000 g , Pepsin and cysteine 25 g each , X gal 5 bromo 4 chloro 3 indolyl beta D galactopyranoside 1 g , 10 micro leter IPTG iso propylthio beta D galactopyranoside 5 g , Columbia agar 500 g , DNA extraction kit for bacteria 1 pack , Molecular primer 27F 5AGAGTTTGATCCTGGCTCAG 3 and 1492R 5 TACGGTACCTTGTTACGACTT3 , Wurster reagent N N N N tetramethyl pphenylenediamine 10 g , Sucrose lactose maltose glucose fructose xylose sorbitol 500 g each , D Arabinose 100 g , D Reffinose 100 g , Gram staining kit 200 ml reagents , Trypsin 10 g , Nutrient Agar 500 g , Nutrient Broth 500 g

Dg Armed Forces Medical Service Tender for Dry View Fuji/ Konica Film & Medical Supplies in Kangra Himachal Pradesh 2025

Dg Armed Forces Medical Service

KANGRA, HIMACHAL PRADESHPosted 9 Nov

GEMGoods3 Documents

Category: Dry View Fuji film For CR Machine 12 x 10 , Dry View Konica film for CR Machine SD E 12 x 10 , Suction catheter FR 6 , Suction Catheter FR 8 , Suction Catheter FR 10 , Suction Catheter FR 12 , Suction Catheter FR 14 , Syp paracetamol 250 mg , Syp Dextromethorphan Hydrobromide and Chlorpheniramine Maleate Bott 60 ml , Clearwax ear drops , Betamethasone cream , AMBU BAG 500 ml , Infant BP cuff manual , Paediatric BP Cuff Manual , Tegaderm Dressing small , Intraosseus needle Paediatric , Disposable Spo2 Probes Nellcor , Yankur Suctor connector , Central line triple lumen size 3F , Central line triple lumen size 4F , Central line triple lumen size 5F , HME Filter , MMR vaccine single dose 0 PT 5ml , Pneumococcal Polysaccharide Vaccine PPSV 23 , Hepatitis A vaccine , H 360 Erba Diluent , H 360 Erba lyser , E lite H Clean Erba , PCI Lyte elctrolyte Reagent , Wire Loop Nychrome , Nepafenac micronized suspension 0 PT 1 with Stablized Oxychloro complex , Lutein 5 mg PLUSZeaxanthin 1 mg PLUSOmeza 3 fatty acids 500mg , Triamcinolone 40mg SLASH ml Preservative Free Inj for Intravitreal Use , HPMC 0 PT 3 Dextran 70 0 PT 1 Glycerin 0 PT 2 Sodium Perborate 0 PT 28mg , Voriconazole Eye Drops , Besifloxacin ophthalmic suspension 0 PT 6 , Tobramycin and Flurometholone eye drops , Gatifloxacin 0 PT 3 PLUSDexamethasone 1 Vial Of 5ml Eye Drops , Hyaluronidase 1500 IU Inj , Hydroxy Propyl Methyl Cellulose 2 Eye Oint , Moxifloxacin 0 PT 50 Oint , Needle Disposable 26 G , Needle Disposable 30 G , Rose Bengal Dye , Sterile Irrigating Balanced Salt Soln BSS For Ophthalmic Surgery Bott Of 500 ml , Sterile Eye patch with adhesive Disposable , Multipiece hydrophobic acrylic IOLwith blue PMMA haptics RI not less than 1 PT 50 , Inj Sodium Hyaluronate 30 mg SLASH ml with Sodium Chondroitin sulphate 40 mg SLASH ml , 2 PT 3 sodium Hyaluronate 0 PT 60 ml Average molecular weight 32 00 999 Daltons , Mini monaka stent , silicon lacrimal punctal plugs , Inj Tropicamide PLUS Phenylephrine Hydrochloride PLUSLidocain , Ripasudil 0 PT 4 eye drop bottle of 5 ml , Netarsudil 0 PT 02 eye drop bottle of 3 ml , FMS Packs for ALCON LAUREATE Phaco Machine , D Dimer 1X20 test , HbA1C 1X20 test , Quantative CRP 1X20 test , Dengue kit 1X10 test , Typhi Dot 1X50 test , Bovine Albumin , Petri Dish for culture AND sensitivity , Readymade Leishmen Stain , tab pentoxyphyline 400mg , tab thiamine100 mh , influenza vaccine , orosore gel , INJ NEUROBION , adult diaper Medium , adult diaper Large , adult diaper xl , adult diaper xxl , band aid , typhoid polysaccharide vaccine , tab linagliptin 5mg , cap itraconazone 100mg , Syp n cold , Syp tixilix , prolene no 1 loop round body , laproscopic drape

Refine Your Search

Quick filters based on popular searches

Popular

Top States

Top Cities

Top Organizations

Sources

Click any filter to narrow down your results • Applied filters shown with opacity

Dg Armed Forces Medical Service Widal Test Kit and Reagents Tender Kangra Himachal Pradesh 2025

Dg Armed Forces Medical Service

KANGRA, HIMACHAL PRADESHPosted 15 Dec

GEMGoods3 Documents

Category: Widal Test Kit , CRP Quantative 1 20 test , HbA1c Tulip Turbodyne 1x , DspaceDimer 1x20 Test T , EspaceCheck Quality , RA Factor Qualitative , PC Lyte Electrolyte Reagent , Sterile Urine Container , Kit for Estimation of Ckspa , Dengue J Mitra NS1Ag and I , Prothrombine Time Reagent , Cell Pack XPspace100 , Stromatolyser XPspace100 , Readymade Leishman St , Muller Hinton Agar MHA , Slide Microscopic Thickne , Micro Cover Glasses 22x50 , VDRL Rapid Test Kit pack of , Wire Loop for Culture , Strips Albumin and Glucose , Swab Stick , PTTK Test Kit with Cacl2 , Cell Clean Sysmax , Multi Stick 10SG pkt of 100 Urosticks Siemens , Blood Sedimentation Rate P , Elisa Reader Thermal Paper , Pci Lyte Print Paper Roll , Pci Lyte Pump Tube , Pci Lyte Deproteinizer , Pci Lyte Cleaning Sol , Pci Lyte Activating Sol Electrolyte Analyser , Gram Stain Kit , ZN Stain Kit , CRP Qualitative , Serum Anti A1 , Anti D IgG and IgM , Serum Anti H 1x5 ml , Serum Anti Human Globulin , Bovine Serum Albumi , Anti D IgG Bott of 10 ml , Anti D IgM Bott of 10 ml , Formaldehide 40percent , Abs Alcohol Dehydrate , Acetone Commersial , Parafin Wax , Acid Sulfuric Commersial , Rapid PAP Stain , Xylene , Readymade Hemotoxyline Stain , Blood Agar Base , Cled Agar with Indic , Sugar Set Readymade for , Sabouraud Dextrose Agar , KOH 40percent , KOH 20percent , Settle Plate , Rodac Plate , LPCB , Gentamycin 10 mcg ABST , Netilmicin 30 mcg ABS , Levofloxacin 5 mcg ABS , Ciprofloxacin 5 mcg A , Trimethoprim 1 25slas , Naldixic Acid 30 mcg ABST , PipracilinslashTazobact , Cefotaxime 30 mcg ABST , Meropenem 10 mcg AB , Norfolaxacin 10 mcg ABST , Clindamycin 2 mcg ABST , Amikacin 30 mcg ABST , Vancomycin 30 mcg ABS , Linezolid 30 mcg ABST Di , Ofloxacin 5 mcg ABST Disc , Imipenem 10 mcg ABST Di , Tobramycin 10 mcg ABST , Ampicillin 10 mcg A , Nitrofurantoin 300 , Ceftazidime 30 mcg ABST , Amoxyclav 30 mcg A , Ceftriaxone 30 mcg , Cefixime 5 mcg ABST Disc , CefoperazoneslashSulbact , Amoxycillin 30 mcg ABST , CSF Microprotein Detection , CSF Globulin Detection Kit , Feather Microtome Blade